C-terminal region of Rv1039c (PPE15) protein of Mycobacterium tuberculosis targets host mitochondria to induce macrophage apoptosis

doi:10.21203/rs.3.rs-3910030/v1

Download PDF

Research Article

C-terminal region of Rv1039c (PPE15) protein of Mycobacterium tuberculosis targets host mitochondria to induce macrophage apoptosis

https://doi.org/10.21203/rs.3.rs-3910030/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 14 Apr, 2024

Read the published version in Apoptosis →

You are reading this latest preprint version

The genome of Mycobacterium tuberculosis (Mtb) encodes a unique family called Proline-Glutamate/Proline-Proline-Glutamate (PE/PPE) gene family, which is exclusive to pathogenic mycobacterium. Several proteins of this family are known to be virulent and utilize host signalling and cell death pathways leading to host immune response modulation, but functions of many of the PE/PPE proteins are yet to be identified. We studied the Rv1039c (PPE15) protein, which is known to be expressed at later stages of infection and known to be upregulated during dormancy. The C-terminal region of Rv1039c was found to be disordered, coiled and hydrophobic in nature and was observed to target the mitochondria of THP1 macrophages. Rv1039c with a deleted C-terminal reduced the mitochondrial perturbations, resulting in reduced depolarization of the mitochondrial membrane and the generation of mitochondrial superoxides. The C-terminal region of Rv1039c is responsible for activation of caspases 3, 7 and 9 along with enhanced expression of pro-apoptotic factors like Bax and Bim. Rv1039c also induced Cytochrome-C release from the mitochondria. Additionally, the C-terminal region of Rv1039c was observed to upregulate the expression levels of TLR4-NF-κB-TNF-α and antigen presenting HLA-DR molecules. These findings revealed that the C-terminal region of Rv1039c is a molecular mimic of a pro-apoptotic host protein, inducing mitochondria-dependent macrophage apoptosis.

Mycobacterium tuberculosis

Rv1039c (PPE15)

C-terminal region

caspase-dependent macrophage apoptosis

mitochondrial perturbations

Mycobacterium tuberculosis (Mtb) has infected more than 25% of world’s population. Mtb has adopted several strategies for its survival and replication within the host [1] for which it has repertoire of effector proteins. One such family of proteins is Proline-Glutamate/Proline-Proline-Glutamate (PE/PPE) family comprising of antigenic, redundant, intrinsically disordered proteins (IDPs) and are exclusive to pathogenic mycobacterium [2]. The PPE gene family has conserved PPE residues at their N-terminus and has variable C-terminus [3]. Recently, few PE/PPE proteins have been identified to possess eukaryote-like domains/motifs in them which further help to modulate host cellular processes for successful infection [4][5][6][7]. The C-terminal regions of several proteins are known to be disordered and hydrophobic which makes it crucial for the function of a protein and their involvement in numerous cellular processes such as protein folding, protein trafficking, binding, signalling and many more [8]. The proteins involved in host apoptotic pathway such as p53, Bcl-x_L, members of BH3-only proteins and Bcl-2 family proteins are known to possess long disordered regions with hydrophobic C-terminal domains [9][10].

Mtb proteins have also been discovered to contain multiple domains and motifs resembling those found in the host proteins, thereby strengthening the notion of molecular mimicry [11][4][5][7]. The importance of C-terminal region of pro-apoptotic proteins has been extensively studied. The pro-apoptotic protein, Bax with truncated C-terminal is unable to get in the mitochondria thereby, inhibiting apoptosis [9]. The C-terminal domain of PE/PPE proteins such as PPE37 and PE6 have been known to target host cell organelles and induce apoptosis [5][7]. The deletion of C-terminus of a protein or any mutation in this region can compromise the binding or function of a protein.

Host organelle targeting is one of the strategies utilized by Mtb to modulate the host cellular pathways [12]. The PPE proteins have been discovered to target the host cell organelles which are crucial for maintenance of cellular homeostasis and processes [13][14][7][15][16]. Mitochondria being a critical cellular organelle, involved in energy production, maintenance of homeostasis and regulation of cell death pathways is targeted by pathogens. During infection, mitochondria get stressed and its inherent role is disturbed which lead to cell death [17][18]. Activation of apoptotic pathway releases apoptotic factors leading to depolarisation and permeabilization of mitochondrial membrane [19][20]. This leads to reduced ATP generation, increased production of mitochondrial superoxides (MitoROS) and release of Cytochrome C (Cyt-C) [19][21][22]. Subsequently, initiator caspase 9 is activated, which in turn, activates executioner caspases 3 and 7, ultimately leading to apoptosis [23]. Few PE/PPE proteins induce apoptosis by targeting the host cell mitochondria [14] [7][24][16]. These organelle targeting proteins possess the organelle targeting signal sequences which navigate them to reach the host cell organelle [25].

Mtb is shown to prevent macrophage apoptosis to survive within the host, however recently many reports suggest that Mtb deploy effectors that induce apoptosis to disseminate within the host during late stage of infection [26]. Therefore, understanding the temporal expression of such proteins and their function is important. Pattern recognition Receptors (PRRs) like Toll-like receptors (TLRs) are mediators of immune response pathways which have been associated with host cell death. TLRs activate the TNF-α mediated signalling cascade to promote the pathogen survival within the host.

We selected Rv1039c (PPE15), a late stage expressing PE/PPE protein which is upregulated during dormancy [27]. We observed that C-terminal region of Rv1039c shares sequence similarity with the C-terminal region of mitochondria-targeting pro-apoptotic Bcl2 proteins. Further analysis revealed the presence of nine mitochondria targeting signal sequences (MTS) in Rv1039c, majorly spanning the C-terminal region of the protein. These observations guided us to delete the C-terminal region of Rv1039c and to investigate its role in targeting host mitochondria and studying the apoptosis inducing mitochondrial perturbations. We observed that C-terminal region of Rv1039c is responsible for inducing mitochondrial stress in THP1 macrophages by depolarizing the MMP, generating mitochondrial superoxides and depleting the ATP levels. Full-length Rv1039c induced the caspase-mediated apoptotic cell death unlike Rv1039c-/-Cterm protein in THP1 macrophages. Rv1039c knock-in M. smegmatis also induced mitochondrial perturbations and macrophage apoptosis more than the Rv1039c-/-Cterm knock-in M. smegmatis. Significant expression of TLR4, antigen presenting HLA-DR molecules and increased production of pro-inflammatory cytokines TNF-α and IL-1β were observed in response to Rv1039c as compared to Rv1039c-/-Cterm protein. These observations showed that C-terminal region of Rv1039c is a molecular mimic of pro-apoptotic host protein and induces mitochondria dependent macrophage apoptosis.

1. Prediction of C-terminal region of Rv1039c and multiple sequence alignment with mitochondria-targeting pro-apoptotic proteins

The protein sequence of Rv1039c was retrieved from Mycobrowser. The secondary structure and hydrophobicity of Rv1039c was predicted through Minnou server (https://minnou.cchmc.org/). The C-terminal region in Rv1039c was predicted through Interpro server [28]. The protein sequences of mitochondria-targeting eukaryotic pro-apoptotic Bcl2-family and BH3-only proteins containing C-terminal regions were retrieved [9]. The Multiple sequence alignment (MSA) was performed for the predicted C-terminal region of Rv1039c with the C-terminal regions of mitochondria-targeting Bcl2-family and BH3-only pro-apoptotic proteins using ClustalW [29]. The alignment files were subjected to ESPript for visualization of the conserved residues (https://espript.ibcp.fr/ESPript/ESPript/). The disorderedness of Rv1039c protein was predicted using PONDR server (http://www.pondr.com/).

2. Cloning, expression and purification of Rv1039c and Rv1039c-/-Cterm recombinant proteins and construction of knock-in M. smegmatis

Rv1039c gene was amplified from Mtb H₃₇Rv genomic DNA as a template using the specific primers and cloned in pGEM-T vector into E. coli DH5α. This was followed by expression of these genes in pET28a(+) vector in E. coli BL21(DE3) expression host. The Rv1039c gene with deleted C-terminal region (Rv1039c-/-Cterm) was cloned in pMSQSCHS vector followed by expression in pET28a(+) vector in E. coli BL21(DE3). Induction was done with 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) and incubated for 3 hrs at 37ºC followed by overnight incubation at 16ºC. Cells were then harvested and sonicated to separate the supernatant from the inclusion bodies. Both the recombinant proteins were purified through Ni-NTA affinity chromatography using the sonicated supernatants. The recombinant proteins were eluted using increasing concentrations of imidazole to 250mM. Eluted samples were loaded onto the SDS-PAGE gel to confirm the purity of proteins and the His-tagged recombinant proteins were confirmed by immuno-blotting using anti-His antibody (Abcam). The protein samples were dialysed against PBS for overnight at 4ºC. The endotoxins were removed by treating the proteins with Polymyxin-B agarose beads (Sigma Aldrich) and endotoxin levels were estimated through Limulus Amebocyte Lysate (LAL) assay kit (ThermoFisher). The concentration of recombinant proteins was estimated using Bicinchoninic acid (BCA) assay kit and the aliquots were stored at -80ºC till further use.

Rv1039c and Rv1039c-/-Cterm genes were also cloned in pMV261 shuttle vector with the His/HA tag for constructing knock-in strains of M. smegmatis mc²155. The successful cloning of Rv1039c and Rv1039c-/-Cterm genes in pMV261 vector was confirmed through plasmid digestion and sequencing. The clone having an empty pMV261 plasmid vector alone was named Ms_Vec and the clones containing Rv1039c and Rv1039c-/-Cterm genes were named Ms_Rv1039c and Ms_Rv1039c-/-Cterm.

3. Culture of THP1 macrophages

THP1 cell line (NCCS, Pune) is a human monocytic cell line maintained in RPMI-1640 medium (Sigma) supplemented with 10% heat inactivated Foetal Bovine Serum (HiMedia) at 37ºC and 5% CO2. THP1 monocytes were treated with 40ng/ml of phorbol 12-myristate 13-acetate (PMA) overnight to differentiate them into macrophages. Following day, the cells were supplemented with fresh media and protein stimulation was given. Unstimulated cells were considered as negative control; and cells stimulated with 40ng/ml of LPS (Sigma) or 2µM of Staurosporine (Sigma) was taken as positive controls for our study. The THP1 macrophages were treated with 10µg/ml of Rv1039c or Rv1039c-/-Cterm proteins. In M. smegmatis infection studies, THP1 macrophages were infected with Ms_Vec or Ms_Rv1039c or Ms_Rv1039c-/-Cterm at a MOI of 10:1 (bacteria:THP1 macrophages).

3.1 Cell Titer Blue assay for cell viability

THP1 macrophages were treated with different doses of recombinant Rv1039c and Rv1039c-/-Cterm proteins (5µg, 10µg and 15µg) to study the dose dependent cell viability in response to our proteins. The cell viability in a time dependent manner after 16, 24 and 48 hrs of incubation was studied in response to 10µg of Rv1039c and Rv1039c-/-Cterm proteins. After respective incubations, 20µl of Cell Titer Blue reagent (Promega Corporation) was added to each well and incubated for 3–4 hrs at 37ºC. Cell Titer Blue reagent contains dark blue coloured rezazurin. In the presence of biological activity, it gets converted into highly fluorescent dark pink coloured resofurin. Absorbance was then measured at 570–600 nm spectrophotometrically. Percentage cell viability was calculated utilizing the absorbance values.

4. Localization of Rv1039c and Rv1039c-/-Cterm proteins in host cell mitochondria and their impact on mitochondrial perturbations

4.1 In-silico prediction for mitochondrial localization of Rv1039c

We conducted in-silico analysis using the DeepMito server (http://busca.biocomp.unibo.it/deepmito/) to predict the likelihood of mitochondrial localization of Rv1039c. Additionally, we utilized the LocSigDB database (http://genome.unmc.edu/LocSigDB/) to obtain a list of signal sequences associated with organelle targeting and localization for mitochondria. The database primarily comprises experimental protein localization signals found in eukaryotic or bacterial cells. We subsequently examined all the listed mitochondria targeting signal sequences for their presence within Rv1039c using the FIMO tool within MEME suite version 4.11.2 (https://meme-suite.org/meme/tools/fimo).

4.2 Mitochondrial localization of Rv1039c and Rv1039c-/-Cterm through confocal microscopy

The recombinant Rv1039c and Rv1039c-/-Cterm were labelled with Alexa Fluor™ 488-FITC Dye from ThermoFisher Scientific following the manufacturer's protocol. Subsequently, we stimulated THP1 macrophages with Alexa Fluor-488 labeled Rv1039c and Rv1039c-/-Cterm proteins for durations of 6, 16, and 24 hours. The cells were stained with MitoSpy Red CMXRos from BioLegend for marking mitochondria, and DAPI from BioLegend was used to stain the cell nuclei. The slides were examined using a confocal microscope (Leica TCS SP8) at the Central Instrumentation Facility, South Campus, University of Delhi.

4.3 Detection of alterations in MMP and generation of superoxides

After incubating the protein stimulated or recombinant M. smegmatis infected macrophages for 6, 16, and 24 hours, cells were harvested and labelled with JC-1 (5, 5', 6, 6'-tetrachloro1, 1', 3, 3'-tetra-methyl-benzimidazolyl-carbocyanine iodide) dye at a concentration of 2.5µg/ml and incubated for approximately 20 minutes at 37ºC. Subsequently, any remaining traces of dye were removed by washing the cells with 1xPBS. The cells, after being washed, were resuspended in 200µl of PBS and subjected to analysis using flow cytometry (BD Accuri C6 flow cytometer) with appropriate gating. In cells where the mitochondrial membrane potential (MMP) was disrupted, JC1 did not accumulate in the membranes of mitochondria, causing the dye to be released into the cytoplasm and emitting green fluorescence signals. Conversely, in cells with an intact MMP, JC1 gets aggregated and emitted red fluorescence. Hence, the MMP change was assessed by calculating the ratio of red to green fluorescence signals. A decrease in this ratio indicated membrane depolarization, while an increase indicated membrane hyperpolarization.

Rv1039c or Rv1039c-/-Cterm stimulated or Ms_Rv1039c or Ms_Rv1039c-/-Cterm infected THP1 macrophages were incubated for 6, 16, and 24 hours followed by addition of 5µM of MitoSOX™ Red dye (ThermoFisher Scientific) and incubated the cells at 37ºC for 20–30 minutes. After incubation, the cells were washed and detected the signal using BD Accuri C6 flow cytometer. MitoSOX™ Red reagent assesses the generation of superoxides within the mitochondria and serves as a specific indicator for mitochondrial superoxides, emitting red fluorescence upon oxidation by superoxides within the mitochondria.

4.4 Alterations in intracellular ADP/ATP ratio

The ADP/ATP ratio was estimated in response to Rv1039c and Rv1039c-/-Cterm by conducting the experiment following the manufacturer’s instructions of ADP/ATP ratio kit (Sigma-Aldrich). The formulae (RLU_C -RLU_B/ RLU_A) was used for calculating the ADP/ATP ratio where RLU_A is RLU for ATP assay, RLU_B is background for ADP assay and RLU_C is RLU for ADP assay. Unstimulated cells were considered as control and its ADP/ATP ratio was considered as 1. The increase in ADP/ATP ratio is indicative of apoptotic cell death.

5. Determination of apoptosis inducing potential of Rv1039c and Rv1039c-/-Cterm

5.1 LDH release assay

LDH release assay kit was used to detect the levels of cytotoxicity induced in response to Rv1039c and Rv1039c-/-Cterm. 20µl media of protein stimulated THP1 macrophages after respective incubations was collected and transferred to new wells. 20µl reaction buffer was added to 20µl media supernatant and incubated for 30 mins at room temperature. Then 20µl stop solution was added to stop the reaction. Absorbance at 490nm was measured in spectrophotometer. LDH is the Lactate dehydrogenase enzyme released from the cytosol in the culture media after damage of plasma membrane.

5.2 AnnexinV/PI assay

After respective incubations, Rv1039c or Rv1039c-/-Cterm recombinant proteins or control stimulated THP1 macrophages were harvested and resuspended in Annexin V (AV) binding buffer. THP1 macrophages were infected with Ms_Vec or Ms_Rv1039c or Ms_Rv1039c-/-Cterm at MOI of 10:1 for 16, 24 and 48 hrs. After respective incubations, the macrophages were washed using PBS and re-suspended in AV binding buffer. 5 µl FITC labelled AV and propidium iodide (PI) (Thermo Scientific) was added and incubated for 10 min in dark at room temperature. The cells were then acquired in flow cytometer and analysed using FL1 and FL3 channels for AV and PI respectively. Exposure of phosphatidylserine on outer leaflet of plasma membrane is the characteristic feature of cells undergoing early apoptosis which is detected by AV-FITC. On the other hand, the cells undergoing late apoptosis were detected through PI. AV positive/PI negative indicates early apoptosis and AV/PI dual positive indicates late apoptosis.

5.3 TUNEL assay

THP1 macrophages stimulated with Rv1039c and Rv1039c-/-Cterm recombinant proteins were incubated for 16, 24 and 48 hrs. Cells were harvested and fixed in 1% formaldehyde solution. The cells were then resuspended in 70% ethanol and incubated on ice for 30 mins and stained with APO-Direct kit (BD Pharmagen). The cells were acquired and analysed through BD accuri flow cytometer. During apoptosis, the DNA breaks and these DNA breaks were detected by a terminal de-oxynucleotidyltransferase (TdT) polymerase which attaches fluoresceinated-dUTP (FITC-dUTP) at 3'-OH end of the DNA.

5.4 Expression levels of pro-apoptotic and anti-apoptotic factors

THP1 macrophages were stimulated with our proteins and mRNA was isolated using MRNA synthesis kit (Promega) after the incubation of respective time periods. The mRNA was converted to cDNA by reverse transcription using cDNA synthesis kit. The expression levels of pro-apoptotic genes (Bax and Bim) and anti-apoptotic gene (Bcl2) were quantified through RT-PCR. The relative quantification of gene expression levels was done as ratio of Bax/Bim/Bcl2 with respect to expression of GAPDH (housekeeping gene). Following set of primers was used for RT-PCR:

Bax: FP: ATGGAGCTGCAGAGGATG; RP: TGTCCAGCCCATGATGGTTC

Bim: FP: TGATTACCGCGAGGCTGAA; RP: ACCAGACGGAAGATAAAGCGTAAC

Bcl2: FP: GTGAGAAGTGAGGGACCTTTATG; RP: ACTCATTAGCCATATCCAACTTG

GAPDH: FP: AAGGGCATCCTGGGCTACAC; RP: GTCCACCACCCTGTTGCTGTAG

5.5 Release of Cytochrome-C by Rv1039c and Rv1039c-/-Cterm

After 16, 24 and 48 hrs of protein stimulation, THP1 macrophages were harvested and their membrane was permeabilized, fixed and stained with FITC labelled anti-human cytochrome-c antibody (Clone-6H2, Thermo Fisher Scientific) for an hour at 4ºC. The cells were washed with 1xPBS and analysed by flow cytometry.

5.6 Activation of Caspases by Rv1039c and Rv1039c-/-Cterm

During apoptosis, activation of caspase cascade is a characteristic feature which is initiated through activation of initiator caspase 9. Activation of caspase 9 was detected by treating the THP1 macrophages with our proteins. The cells were lysed in 1xRIPA lysis buffer (Santa Cruz Biotechnology) and whole cell lysate (WCL) was collected. The WCL was boiled in lamaelli buffer for 5 mins and loaded on SDS-PAGE gel. The gel was transferred to nitrocellulose membrane for western blotting. The membrane was blocked using 5% skimmed milk and incubated with anti-caspase 9 antibody (1:10000) (PAA627Hu03, Cloud-Clone Corp.) followed by incubation with secondary antibody conjugated with peroxidase. The blot was stripped and reprobed with anti-GAPDH antibody (1:10000) (Thermo Scientific) for loading control. The blot was developed with the use of Pierce™ ECL reagent (Thermo Scientific) through Amersham ChemiDoc System. ImageJ software was used to quantify the intensity of blots.

Initiator caspase activates the executioner caspases 3 and 7 to induce apoptosis. To study the activation of executioner caspases, Rv1039c or Rv1039c-/-Cterm protein stimulated THP1 macrophages were harvested and stained with 500nM Cell Event Caspase 3/7 reagent (Invitrogen) and incubated at 37ºC for 30 mins. 1µM SYTOX AADvanced dead cell stain (Invitrogen) was added and analysed in flow cytometer (BD accuri). On activation of Caspase 3 and 7, the caspase 3/7 recognition peptide (DEVD) is cleaved which is detected by Cell Event Caspase 3/7 detection reagent whereas SYTOX AADvanced dead cell stain differentiates between apoptotic and necrotic cells. Subsequently, to validate whether Rv1039c induced apoptosis is caspase dependent, inhibition studies were performed by pre-treating the cells with Z-VAD-fmk (Promega), a pan caspase inhibitor for 1 hr followed by protein stimulation and caspase mediated apoptosis was evaluated at 24 hrs through AV/PI assay.

6. Modulation of host immune response by Rv1039c

6.1 Interaction of Rv1039c with TLRs through docking studies

Protein structures of human TLR2 and TLR4 were retrieved from RCSB protein databank using 3FXI and 2Z7X PDB IDs respectively. The protein sequence of Rv1039c was subjected to I-TASSER for homology modelling. The structure with best C-score was subjected to Chiron server. Chiron refined 3D structure of Rv1039c was docked with TLR2 and TLR4 through HADDOCK2.2 server. The comparison of the two complexes was made on the basis of HADDOCK score and Z-score. More negative score represents better structure.

6.2 Dot blot binding assay to study the interaction of Rv1039c with TLR2 and TLR4

Dot blot binding assay was performed to validate the interaction of Rv1039c with TLR2 and TLR4. WCL was prepared from the untreated THP1 macrophages using 1xRIPA lysis buffer. To look for the interaction of Rv1039c with eukaryotic proteins 5µg of lysate was transferred on nitrocellulose membrane (BioRad) and left to dry. The membrane was blocked with 5% skimmed milk, washed and incubated with Rv1039c protein. The blot was incubated with monoclonal anti-His Antibody (1:1000) (Abcam) followed by secondary antibody (1:2500) (Jackson ImmunoResearch) and the blot was developed using ECL reagent. Further, to confirm the interaction of Rv1039c with TLR2 or TLR4, Rv1039c protein was immobilized on nitrocellulose membrane, blocked and incubated with WCL. Monoclonal anti-Human TLR2 or TLR4 antibodies (1:1000) (eBiosciences) were added followed by HRP-conjugated secondary antibody. Additionally, negative control of 1xPBS was used with each blot. The blots were extensively washed five times with 1xPBST after each step. Reactive spots were developed on Amersham ChemiDoc System using ECL Pico substrate. The intensity of dot blots was quantified using ImageJ software.

6.3 Detection of expression profile of TLRs in response to Rv1039c and Rv1039c-/-Cterm

Rv1039c or Rv1039c-/-Cterm stimulated THP1 macrophages were incubated for 24 and 48 hrs. Cells were harvested and stained with APC labelled anti-human TLR2 (CD282) antibody or TLR4 (CD284) antibody and incubated for 20 mins at 4ºC followed by analysis through flow cytometer and percentage of stained cells was estimated. A TLR2 agonist (Cell wall fraction of H₃₇Rv from BEI resources) and a TLR4 agonist (LPS) were used as positive controls for TLR2 and TLR4 positive signals respectively. For inhibitor studies, cells were pre-treated with anti-TLR4 at 37ºC for an hour followed by treatment with Rv1039c or Rv1039c-/-Cterm or control proteins for 24 hrs an expression profile was analysed through flow cytometer.

6.4 Expression levels of HLA-DR in response to Rv1039c and Rv1039c-/-Cterm

THP1 macrophages treated with Rv1039c or Rv1039c-/-Cterm proteins were harvested and stained with PE conjugated anti-human HLA-DR from eBiosciences. Labelled cells were incubated for 20 mins at 4ºC and acquired using BD Accuri C6 flow cytometer. Inhibition studies were also performed for the change in expression level of HLA-DR in anti-TLR4 pre-blocked macrophages in response to Rv1039c or Rv1039c-/-Cterm through flow cytometer.

6.5 Expression of effector molecule NF-κB and estimation of levels of pro-inflammatory cytokines

THP1 macrophages were treated with Rv1039c or Rv1039c-/-Cterm proteins for 24 and 48hrs for isolation of mRNA using mRNA synthesis kit (Promega) as per manufacture’s protocol. 1µg of mRNA was converted to cDNA (Promega) using cDNA synthesis kit. Quantitative RT-PCR was performed for NF-κB relative quantification in which the target concentration is expressed as ratio of target with respect to the endogenous control gene (housekeeping gene GAPDH) using following primers:

FP5’ATGGCTTCTATGAGGCTGAG3’;

RP5’GTTGTTGTTGGTCTGGATGC3’.

Equal concentration of cDNA for each sample was added to SYBR PCR master mix along with NF-κB primers. RT-PCR was performed for 40 cycles of amplification. The fold change in NF-κB expression level was normalized with the expression levels of GAPDH and the data was calculated using the 2^-∆∆ CT method and are presented as fold induction.

To study the cytokine profiles, the cell culture supernatants from Rv1039c and Rv1039c-/-Cterm stimulated THP1 macrophages incubated for 16, 24 and 48 hrs were collected. ELISA was performed following manufacturer’s instructions for the release of TNF-α (Thermo Scientific ELISA kit) and IL-1β (Biolegend ELISA kit) pro-inflammatory cytokines in response to Rv1039c and Rv1039c-/-Cterm proteins.

Statistical analysis

The results of three individual experiments are presented as Mean ± SEM. Student’s t-test was employed for comparisons using Graph Pad Prism software version 5.02 (San Diego, CA, USA). The differences in mean were analysed and were considered significant at p < 0.05;

*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001.

1. Defining the C-terminal region of Rv1039c

Interpro server predicted the presence of C-terminal region in Rv1039c spanning from 310 to 387 amino acid residues. The protein was found to be 65% disordered and the disorderedness in the C-terminal region of Rv1039c spans from 310 to 370 amino acid residues covering ~ 83% of the C-terminal region. The structural predictions of this protein showed that this C-terminal region of Rv1039c is mostly composed of coils and hydrophobic residues which make this region disordered and hydrophobic (Fig. 1a, b). The C-terminal region of Rv1039c also has similarity with eukaryotic SH3-domain (manuscript under publication). It also possesses five out of nine MTS. The C-terminal region of pro-apoptotic Bcl2 and BH3-only proteins has also been reported to be disordered, hydrophobic and crucial for their function. MSA of C-terminal region of Rv1039c was performed with the known C-terminal regions of mitochondria-targeting eukaryotic pro-apoptotic Bcl2 proteins. We observed that the C-terminal region of Rv1039c shows similarities with that of mitochondria targeting pro-apoptotic Bcl2-family and BH3-only proteins involved in apoptosis (Fig. 1e). Therefore, the stretch of Rv1039c from 312–367 residues which is highly disordered, coiled, hydrophobic and has similarity with C-terminal regions of mitochondria-targeting pro-apoptotic proteins was designated as C-terminal region of Rv1039c (Fig. 1c, d).

2. Cloning, expression and purification of Rv1039c and Rv1039c-/-Cterm recombinant proteins and construction of knock-in M. smegmatis

The full-length Rv1039c gene was cloned and expressed in Pet(28a+) vector in E. coli BL21(DE3) strain. The recombinant Rv1039c protein of 38kDa was purified using 100mM of Imidazole and confirmed by western blotting using anti-His antibody. The Rv1039c with deleted C-terminal (Rv1039c-/-Cterm) (312 to 367 amino acid residues) from the full-length gene was cloned in pMSQSCHS and expressed in Pet28a(+) vector in E. coli BL21(DE3) strain. The recombinant Rv1039c and Rv1039c-/-Cterm proteins of 38kDa and 30kDa respectively were purified by Ni-NTA affinity chromatography and confirmed by western blotting using anti-His antibody (Fig. 2a). Negligible amount of endotoxin levels was detected in the purified proteins. The pMV261 shuttle vector harbouring Rv1039c or Rv1039c-/-Cterm gene was confirmed by restriction digestion and positive clones were electroporated in M. smegmatis mc²155 (Fig. 2b).

3. C‑terminal region of Rv1039c protein induces cell death of THP1 macrophages

We studied the viability of THP1 macrophages in response to Rv1039c and Rv1039c-/-Cterm proteins. Initially, dose dependent loss of viability was studied by stimulating the THP1macrophages with three different doses of protein (5µg/ml, 10µg/ml and 15µg/ml). We observed ~ 90% viable cells on 5µg/ml protein stimulation. Stimulation with 10µg/ml of protein resulted in over 30% loss in viability, and this loss increased as the protein concentration of Rv1039c was raised (Fig. 3a). On the other hand, we observed comparatively reduced viability loss in Rv1039c-/-Ctrem treated macrophages. We worked further with 10µg/ml of protein concentration for stimulating the cells in all the experiments.

Time dependent study of cell viability was performed using 10µg/ml of protein concentration. We observed viability loss in response to both the proteins in comparison to unstimulated cells but Rv1039c-/-Cterm stimulation caused less viability loss as compared to Rv1039c at all the three time points. A significant increase in viable cells in response to Rv1039c-/-Cterm (~ 20 to 30%) as compared to Rv1039c protein stimulation was observed at 24 hrs and 48 hrs (Fig. 3b). This suggested a possible role of C-terminal region of Rv1039c in inducing host cell death.

4. Rv1039c localizes to host mitochondria and induces mitochondrial perturbations

4.1 Localization of Rv1039c and Rv1039c-/-Cterm proteins in host cell mitochondria

DeepMito server predicted the positive likelihood of Rv1039c to localize in the host mitochondria in the mitochondrial inner membrane with a score of 0.62. Further, sequence analysis of Rv1039c through FIMO tool of MEME suite server using the MTS retrieved from LocSigDB revealed the presence of nine MTS out of 30 variants of MTS. Five of the nine MTS lies in the C-terminal stretch of Rv1039c (Fig. 4a).

The in-silico predictions of presence of MTS in Rv1039c were validated by in-vitro co-localization studies for which Alexa-flour 488 labelled recombinant proteins were used to stimulate macrophages from 6 hrs till 24 hrs to perform confocal microscopy. We observed that Alexa-flour 488 labelled Rv1039c gets localised to mitochondria of THP1 cells at all the three time points. Alexa-flour 488 labelled Rv1039c-/-Cterm protein also gets localised in mitochondria but the signal was observed to be comparatively diffused (Fig. 4b). The surface plots and RGB plots showed reduction in fluorescence intensity in Rv1039c-/-Cterm stimulated cells as compared to Rv1039c stimulated cells (Supplementary Fig. 1). These observations revealed that C-terminal region of Rv1039c partially accounts for mitochondrial localization as some of the MTS are still intact in the Rv1039c-/-Cterm protein.

4.2 C-terminal region of Rv1039c alters the MMP and produces mitochondrial superoxides in THP1 macrophages

Mitochondrial perturbation like disruption of mitochondrial membrane integrity is an indicator of mitochondria-mediated cell death. As we observed that Rv1039c co-localizes host mitochondria so we investigated the potential of Rv1039c and the role of its C-terminal in affecting MMP of host cells We performed flow cytometric analysis using JC1 dye and analysed the ratio of red to green fluorescence. Red fluorescence indicates JC1 aggregation and green fluorescence indicates JC1 monomers. We observed that Rv1039c reduced the red to green fluorescence intensity from 6 hrs till 24 hrs which clearly indicated towards reduced MMP or depolarization of MMP. The controls LPS and staurosporine also showed significant depolarization of mitochondrial membrane in a time dependent manner. On the other hand, on Rv1039c-/-Cterm stimulation was not able to induce any significant change in comparison to unstimulated cells but it was able to significantly reduce the mitochondrial membrane depolarization as compared to Rv1039c stimulated cells. Ms_Rv1039c also showed depolarized MMP as compared to Ms_Vec at all the three time points whereas Ms_Rv1039c-/-Cterm reduced the depolarization as compared to Ms_Rv1039c as depicted in Fig. 5a.

Mitochondria are a rich source of superoxides and perturbations in mitochondria trigger the leakage of electrons from Electron transport chain and the electrons unites with oxygen to produce superoxides. Depolarized MMP, followed by superoxide generation, are some of the preliminary steps that assure cells will irreversibly undergo intrinsic apoptosis. MitoSOX Red dye was used to detect the release of mitochondrial superoxides. We observed that Rv1039c produced significant levels of mitochondrial superoxides as compared to unstimulated cells from 6 hrs to 24 hrs. However, at 6 hrs a reduction in the superoxide release in Rv1039c-/-Cterm stimulated cells was observed as compared to Rv1039c stimulated cells. The positive controls LPS and staurosporine also produced significantly higher levels of mitochondrial superoxides. Ms_Rv1039c infection also increased the generation of mitochondrial superoxides at 6 hrs in comparison to Ms_Vec (Fig. 5b). The gating strategies for flow cytometry analysis is shown in supplementary Fig. 2.

4.3 C-terminal region of Rv1039c disturbs the ADP/ATP ratio

Mitochondrial stress and compromised mitochondrial integrity directly affect the production of ATP, resulting in an elevated ADP/ATP ratio. A high ADP/ATP ratio indicates depletion of cytosolic ATP and disrupted cellular bioenergetics. In response to Rv1039c, we found a significant increase in ADP/ATP ratio from 16 hours to 48 hours as compared to unstimulated cells. Positive controls, LPS and staurosporine stimulation also showed similar results to Rv1039c stimulation. On the other hand, in comparison to unstimulated cells, stimulation with Rv1039c-/-Cterm protein does not show any alterations in ADP/ATP ratio; and on comparison to Rv1039c, Rv1039c-/-Cterm showed significant reduction in ADP/ATP ratio at 6 and 16 hrs (Fig. 6).

5. Role of C-terminal region of Rv1039c in inducing macrophage apoptosis

5.1 C-terminal region of Rv1039c induces apoptotic cell death in host macrophages

To study the apoptotic cell death induced by Rv1039c, AnnexinV/PI and TUNEL assays were performed as phosphatidylserine flipping and DNA fragmentation are one of the characteristic features of apoptotic cell death. AnnexinV-FITC staining determines the exposed phosphatidylserine which defines the early apoptosis whereas PI staining determines the late-stage apoptosis. In response to Rv1039c, AV-FITC and PI dual positive cell population was significantly increased in a time a dependent manner till 48 hrs as compared to unstimulated cells. However, on Rv1039c-/-Cterm stimulation, the percentage of cells showing AV-FITC and PI dual positive cell population got reduced as compared to Rv1039c. After 48 hrs of Rv1039c or Rv1039c-/-Cterm stimulation, statistically significant reduction in AV-FITC and PI dual positive population was observed. LPS and staurosporine were considered as positive controls which showed significant increase in AV-FITC and PI dual positive population in a time-dependent manner (Fig. 7a). Furthermore, the macrophages infected with Ms_Rv1039c also showed significant increase in percentage of AV + AV/PI dual positive cell population at all the three time points as compared to Ms_Vec infection. However, Ms_Rv1039c-/-Cterm infection reduced the percentage of AV + AV/PI dual positive cells in comparison to Ms_Rv1039c at all the three time points (Fig. 7b).

TUNEL assay showed that Rv1039c stimulation led to significant increase in the TUNEL positive cell percentage which increased in a time dependent manner. Statistically significant reduction in TUNEL positive cells was observed on Rv1039c-/-Cterm stimulation at 24 hrs of study (Fig. 7c). These results suggested that the C-terminal region of Rv1039c has a role in inducing apoptosis of host macrophages.

The necrotic cell death in response to recombinant Rv1039c was assessed through LDH release assay. We observed that Rv1039c did not induce significant release of LDH in the medium as compared to the unstimulated cells. Also, the deletion of C-terminal region of Rv1039c did not contribute to LDH release and was comparable to unstimulated and Rv1039c as shown in supplementary Fig. 3. This confirmed that Rv1039c did not induce necrosis.

5.2 C-terminal region of Rv1039c upregulates the expression levels of pro-apoptotic genes

During apoptosis cascade, the levels of pro-apoptotic genes get upregulated. The alterations in expression levels of pro-apoptotic (Bax and Bim) and anti-apoptotic (Bcl2) genes were studies in response to Rv1039c and Rv1039c-/-Cterm after 24 and 48 hrs of protein stimulation. We observed significantly increased expression levels of Bax and Bim in response to Rv1039c at 24 and 48 hrs as compared to unstimulated cells. On Rv1039c-/-Cterm stimulation, the expression levels of Bax and Bim were observed to be downregulated as compared to Rv1039c. On the other hand, no increase was observed in the expression level of Bcl2 in response to Rv1039c and a slight increase was observed in response to Rv1039c-/-Cterm (Fig. 8).

5.3 C-terminal region of Rv1039c induces caspase mediated apoptosis

Formation of apoptosome complex activates the caspase cascade to induce host cell apoptosis. We studied the expression of caspase 9 in Rv1039c and Rv1039c-/-Cterm stimulated THP1 cell lysate. We observed that expression of Caspase 9 was significantly increased in Rv1039c stimulated cells as compared to unstimulated cells and was comparable to positive control LPS stimulated cells. On the other hand, caspase 9 expression got significantly reduced in Rv1039c-/-Cterm stimulated cells as compared to Rv1039c stimulated cells and was comparable to unstimulated cells (Fig. 9b).

We investigated the role of C-terminal region of Rv1039c in activating executioner caspases 3 and 7. We observed that Rv1039c induced significant increase in Caspase 3 and 7 positive cells after 24 and 48 hrs of stimulation as compared to unstimulated cells. However, Rv1039c-/-Cterm showed significant reduction in the activation of caspases 3 and 7 as compared to Rv1039c at both the time points. Positive controls also showed significant increase in activation of Caspase 3 and 7 in comparison to unstimulated cells as shown in Fig. 9a.

Further, in order to confirm that apoptosis induced by Rv1039c is caspase-dependent we pre-treated the THP1 macrophages with pan-caspase inhibitor (Z-VAD-fmk). We observed that this pre-treatment led to decreased percentage of Caspase 3 and 7 positive cells as compared to cells without pre-treatment in response to Rv1039c, LPS and staurosporine. However, pre-treatment with Z-VAD-fmk in Rv1039c-/-Cterm stimulation did not show any change in the percentage of Caspase 3 and 7 positive cells (Fig. 9c). Also, AnnexinV/PI staining showed that pre-treatment with Z-VAD-fmk showed significant downregulation in apoptosis of THP1 macrophages in response to Rv1039c but not in Rv1039c-/-Cterm stimulated cells (Fig. 9d). This confirmed that the C-terminal region of Rv1039c induces caspase-dependent macrophage apoptosis.

5.4 C-terminal region of Rv1039c induces release of Cytochrome C

Apoptotic stimuli and disrupted MMP triggers the release of a characteristic apoptotic protein called Cyt-C from the mitochondria. We observed a significant increase in the percentage release of Cyt-C in the cytosol in response to Rv1039c at all the three time points. The Cyt-C release in Rv1039c stimulated cells was comparable to that of the positive controls, staurosporine and LPS. On the other hand, Rv1039c/-Cterm stimulated cells showed significant reduction in the Cyt-C release as compared to that of Rv1039c as well as unstimulated cells as shown in Fig. 10.

6. C-terminal region of Rv1039c modulates the host immune response by interacting with TLR4

6.1 Rv1039c interacts with TLR4

TLRs are important factors in the recognition of pathogenic Mtb proteins and several PE/PPE proteins were known to interact mostly with TLR2 and TLR4. I-TASSER generated and Chiron refined model of Rv1039c was docked with TLR2 and TLR4 through HDOCK server. Ten docked models were generated and the best model was selected on the basis of docking score and RMSD. Docking studies revealed that Rv1039c can interact with both TLR2 and TLR4 but the docking score of Rv1039c-TLR4 complex (-398.82 kCal/mol) was better than Rv1039c-TLR2 complex (-294.84 kCal/mol). The study of interacting residues revealed that Rv1039c-TLR4 complex has 122 interactions whereas Rv1039c-TLR2 complex has 101 interactions (Fig. 11a(i)). To further validate the interaction of Rv1039c with TLR2 or TLR4, dot-blot binding assay was performed with WCL of THP1 macrophages through anti-TLR2/TLR4 antibodies (Fig. 11a(ii)). We observed that Rv1039c interacted significantly with TLR4 as compared to TLR2.

6.2 Rv1039c upregulates the surface expression of TLR4 and HLA-DR on THP1 macrophages

Rv1039c stimulation to THP1 macrophages led to significant increase in surface expression of TLR4 whereas no upregulation was observed in TLR2 expression as compared to unstimulated cells at 24 hrs and 48 hrs which was estimated by flow cytometry. However, the deletion of C-terminal of Rv1039c led to significant downregulation of TLR4 expression on THP1 macrophages. LPS (a TLR4 agonist) was considered as a positive control for TLR4 which showed significant increase in TLR4 expression but not in TLR2. On the other hand, Cell Wall Fraction (CWF) (a TLR2 agonist) was considered as a positive control for TLR2 which showed significant increase in TLR4 and TLR2 expression respectively. We also observed a significant upregulation of HLA-DR expression level in response to Rv1039c at 24 hrs and 48 hrs. Deletion of C-terminal of Rv1039c showed reduced HLA-DR expression. The controls, LPS and CWF also showed significantly upregulated expression of HLA-DR as compared to unstimulated cells (Fig. 11b (i)).

Furthermore, the macrophages were blocked with anti-TLR4 antibody before stimulation with controls or our recombinant proteins to study that the response generated by Rv1039c is TLR4 mediated. On blocking, we observed a significant downregulation in TLR4 positive cells and in the HLA-DR positive cells in response to both Rv1039c and Rv1039c-/-Cterm. The expression level of TLR4 and HLA-DR also get reduced considerably in TLR4-blocked LPS and CWF stimulated cells (Fig. 11b (ii)).

6.3 C-terminal region of Rv1039c upregulates expression of effector molecule NF-κB and cytokine profiles of TNF-α and IL-1β

C-terminal region of Rv1039c induced an increased fold change in mRNA expression of NF-κB at 24 hours and 48 hours. As compared to expression of NF-κB in unstimulated cells, Rv1039c stimulated cells was observed to be three folds at 24hrs and increased to four folds at 48hrs (Fig. 12a). The deletion of C-terminal region from the full-length Rv1039c reduced the expression level of NF-κB.

The generation of certain pro-inflammatory cytokines such as TNF-α and IL-1β has been associated with TLR4-mediated immune response activation and apoptosis. On Rv1039c stimulation to THP1 macrophages, we observed a significant upregulation in the levels of TNF-α and IL-1β in a time dependent manner from 16 hrs till 48 hrs as compared to unstimulated cells. The positive control, LPS also showed significant increase in TNF-α and IL-1β levels at all the three time points.

The level of TNF-α was observed to be considerable reduced on Rv1039c-/-Cterm stimulation as compared to Rv1039c full length protein at all the three time points. On the other hand, the level of IL-1β was reduced in response to Rv1039c-/-Cterm as compared to Rv1039c but not significantly at 16 hrs and 24 hrs. However, at 16 hrs, the downregulation in IL-1β levels in Rv1039c-/-Cterm stimulated cells was significant in comparison to Rv1039c full length protein stimulated cells (Fig. 12b, c).

The PE/PPE family proteins of Mtb have been known for modulating host immune responses and cellular pathways for pathogen survival [30]. These proteins have been linked to antigenic variation and immune evasion due to their high sequence variability and repetitive nature. In order to gain deeper insights about Mtb pathogenesis, the characterization of the PE/PPE proteins is crucial. Some of these proteins have been documented for their ability to target host mitochondria, as mitochondria are crucial cell organelle that can be exploited by pathogens to manipulate the life-death balance to their benefit [7][15][31][32][16][33]. Virulent Mtb strains have the capacity to disrupt the mitochondrial inner membrane, facilitating infection progression and pathogen persistence [19]. The interplay between apoptotic proteins and mitochondria triggers the breakdown of mitochondrial membrane integrity, which, in turn, leads to the generation of mitochondrial superoxides, the release of Cyt-C, and reduced ATP production [34].

The Rv1039c (PPE15) protein of Mtb has been reported to be expressed at 90 days post-infection in the lungs of guinea pig and its expression is heightened during dormancy [35][36]. In-silico analysis revealed the presence of a disordered, coiled and hydrophobic C-terminal region in Rv1039c, spanning from 312 to 367 amino acid residues. Considering its anticipated disordered nature, this C-terminal segment of Rv1039c is expected to exhibit significant structural flexibility and adaptability. The C-terminal region of Rv1039c was also found to be aligned and conserved with the C-terminal region of eukaryotic mitochondria-targeting pro-apoptotic Bcl2-family and BH3-only proteins. The pro-apoptotic proteins associated with mitochondria such as Bax, Bad, Bak, Bnip3, Bid, Bok and Hrk, feature a well-defined C-terminal domain/region that is disordered and hydrophobic and governs their role in the regulation of apoptosis [37]. The C-terminal region of these Bcl2-family and BH3-only pro-apoptotic proteins are known to target mitochondrial outer membrane and regulate apoptosis [9].

In-silico analysis predicted Rv1039c to have nine mitochondrial targeting signal sequences spanning throughout the protein and five of them lie in the C-terminal stretch. The predicted C-terminal was deleted from the full-length Rv1039c and its role in modulating host macrophage apoptosis was investigated. Our in-silico observations were validated by cloning, expressing and purifying the full-length Rv1039c and Rv1039c-/-Cterm recombinant proteins. The mitochondria targeting by Rv1039c was confirmed through confocal microscopy. As the C-terminal region of Rv1039c spans more MTS, the deletion of C-terminal region from the full-length protein reduced the mitochondrial localization of Rv1039c-/-Cterm protein in THP1 macrophages. The C-terminal region of Rv1039c was found to be responsible for its secretory nature (data not shown). The localization of a bacterial effector protein with host mitochondria can induce several perturbations causing abnormal cellular processes [38]. We observed that Rv1039c depolarizes the MMP, whereas Rv1039c-/-Cterm could not alter it. The C-terminal region of Rv1039c induced production of mitochondrial superoxides. The intracellular ATP levels in Rv1039c stimulated cells were observed to be increased unlike Rv1039c-/-Cterm. Several Mtb proteins like HBHA, LpqH, Rv3261 and PE_PGRS33, PE_PGRS45, PE_PGSR1 and PE6 have been reported to target mitochondria and induce mitochondrial perturbations. These mitochondria targeting Mtb effector proteins were also involved in inducing apoptosis [39][40][41][14][24][16][7][15][42]. The role of Rv1039c in disrupting the homeostasis of host mitochondria and inducing mitochondrial perturbations indicates its potential towards its potential to modulate the host cell death pathway towards apoptosis but not necrosis. We observed increased expression of pro-apoptotic genes Bax and Bim in response to Rv1039c, but their expression levels were reduced in response to Rv1039c-/-Cterm.

Depolarization of MMP can lead to the release of Cyt-C from the mitochondria. The Cyt-C, along with several other factors such as apaf-1 and procaspase 9, may lead to the formation of an apoptosome complex in the cytosol, which is essential for the activation of caspases [23]. Rv1039c also leads to release of Cyt-C and activation of initiator Caspase 9 along with executioner caspase 3 and 7 which may lead to apoptotic cell death, as validated by increased AV/AV-PI dual positive cells and TUNEL positive cells. On the other hand, these observations were markedly reduced in response to Rv1039c-/-Cterm protein. This caspase-dependent apoptosis in THP1 macrophages in response to our protein was confirmed by use of a pan-caspase inhibitor. These observations indicate that deletion of C-terminal region from the full-length Rv1039c protein reduced the caspase-dependent macrophage apoptosis. Mtb proteins such as LpqH (Rv3763), Rv3261, PE6, PPE18, PPE32 and PPE37 have been reported to activate caspases and trigger apoptosis [40][41][7][43][44][45]. Our study revealed the importance of C-terminal region in Rv1039c protein which corroborates the studies reporting the role of C-terminal domains of PPE37 and PE6 in inducing host cell apoptosis [5][7].

The host-pathogen interaction is regulated by pathogen associated molecular patterns (PAMP) – pathogen recognition receptor (PRR) interactions, which can modulate the host responses and the cellular cascades such as antigen presentation and macrophage apoptosis for disease progression [46][47]. The PE/PPE proteins are known to be surface exposed or secreted and interact primarily through TLR2 or TLR4 [48]. We observed that Rv1039c interacts with TLR4 and leads to upregulation of TLR4 expression through NF-κB. This also leads to upregulation of macrophage activation marker HLA-DR, along with pro-inflammatory cytokines TNF-α and IL-1β. However, these observations were observed to be downregulated by deleting the C-terminal region of Rv1039c. These observations altogether indicate the importance of the C-terminal region of Rv1039c in inducing host macrophage apoptosis. The PE/PPE family proteins such as PE_PGRS5, PE6 and PE9-PE10 complex have been reported to induce TLR4-mediated apoptosis of host macrophages [49][13][15][50].

Similar to Rv1039c, other PE/PPE family proteins such as PE_PGRS1, PE6 and PE_PGRS5 are also identified at 90 days post-infection (late stage) in guinea pig lungs [35]. These reports provide evidence for the hypothesis that late-stage apoptosis in alveolar macrophages of granulomas is a pro-pathogen event involved in pathogen persistence and dissemination. Due to the nutritional limitations and the need for spread in the late phase of infection, Mtb prefers inducing apoptosis. Therefore, the observed mitochondrial perturbations and caspase-mediated apoptosis of host macrophages could potentially aid in the proliferation of Mtb within the protective apoptotic vesicles. We also observed that Rv1039c increased the intracellular survival of recombinant M. smegmatis expressing Rv1039c within THP1 macrophages and the C-terminal of Rv1039c was observed to be responsible for enhanced intracellular survival (manuscript under publication).

Conclusively, these findings unveil how the disordered C-terminal stretch of Rv1039c exploits the mechanisms to induce mitochondria-mediated macrophage apoptosis for Mtb persistence. The C-terminal of Rv1039c also modulates TLR4-mediated cytokine release, favouring Mtb pathogenesis (Fig. 13). This comprehensive exploration enhances our understanding of the intricate interplay between Mtb and the host immune system, potentially paving the way for the development of novel therapeutic interventions against tuberculosis. The use of supplements that can recover mitochondrial stress can be one of the strategies to target Mtb host-directed therapies.

Author Contributions

Priyanka: Experimental design, Methodology, Investigation, Formal analysis, Data curation, Writing-original draft, Writing-review and editing

Sadhna Sharma: Supervision, Funding acquisition, Review and editing

Monika Sharma: Conceptualization, Experiment design, Methodology, Supervision, Writing-review and editing of manuscript, Funding acquisition, Investigation

ACKNOWLEDGEMENT

We gratefully acknowledge Prof. Mandira Varma Basil, Vallabhbhai Patel Chest Institute, University of Delhi, Delhi for providing the facility for performing M. smegmatis experiments. We gratefully acknowledge Professor Vikas Jain of Indian Institute of Science Education and Research [IISER], Bhopal for providing the Rv1039c-/-Cterm clone in pMSQSCHS vector

CONFLICTS OF INTEREST

None

Ethical Approval

Not applicable

Funding

The financial support by Department of Science and Technology [DST], Government of India [Grant Sanction no. EMR/2016/006774] and Extramural Research grant from MH, R&D cell is gratefully acknowledged. Priyanka is recipient of Senior Research Fellowship from Council of Scientific and Industrial Research [CSIR], Government of India.

Availability of data and materials

All data generated or analyzed during this study are included in this published article (and its supplementary data files). Further enquiries related to the study can be directed to the corresponding author.

Liu CH, Liu H, Ge B (2017) Innate immunity in tuberculosis: host defense vs pathogen evasion. Cell Mol Immunol 14:963–975. https://doi.org/10.1038/cmi.2017.88
Ahmad J, Khubaib M, Sheikh JA, Pancsa R, Kumar S, Srinivasan A, Babu MM, Hasnain SE, Ehtesham NZ (2020) Disorder-to-order transition in PE-PPE proteins of Mycobacterium tuberculosis augments the pro-pathogen immune response. FEBS Open Bio 10:70–85. https://doi.org/10.1002/2211-5463.12749
Ates LS (2020) New insights into the mycobacterial PE and PPE proteins provide a framework for future research. Mol Microbiol 113. https://doi.org/10.1111/mmi.14409
Chai Q, Wang X, Qiang L, Zhang Y, Ge P, Lu Z, Zhong Y, Li B, Wang J, Zhang L, Zhou D, Li W, Dong W, Pang Y, Gao GF, Liu CH (2019) A Mycobacterium tuberculosis surface protein recruits ubiquitin to trigger host xenophagy., Nat. Commun. 10 1973. https://doi.org/10.1038/s41467-019-09955-8
Ahmad J, Farhana A, Pancsa R, Arora SK, Srinivasan A, Tyagi AK, Babu MM, Ehtesham NZ, Hasnain SE (2018) Contrasting Function of Structured N-Terminal and Unstructured C-Terminal Segments of Mycobacterium tuberculosis PPE37 Protein., MBio. 9 https://doi.org/10.1128/mBio.01712-17
Srivastava S, Battu MB, Khan MZ, Nandicoori VK, Mukhopadhyay S (2019) Mycobacterium tuberculosis PPE2 Protein Interacts with p67(phox) and Inhibits Reactive Oxygen Species Production. J Immunol 203:1218–1229. https://doi.org/10.4049/jimmunol.1801143
Medha, Priyanka P, Bhatt S, Sharma M, Sharma (2022) Role of C-terminal domain of Mycobacterium tuberculosis PE6 (Rv0335c) protein in host mitochondrial stress and macrophage apoptosis, Apoptosis. https://doi.org/10.1007/s10495-022-01778-1
Sharma S, Schiller MR (2019) The carboxy-terminus, a key regulator of protein function. Crit Rev Biochem Mol Biol 54:85–102. https://doi.org/10.1080/10409238.2019.1586828
Gómez-Fernández JC (2014) Functions of the C-terminal domains of apoptosis-related proteins of the Bcl-2 family. Chem Phys Lipids 183:77–90. https://doi.org/10.1016/j.chemphyslip.2014.05.003
Peng Z, Xue B, Kurgan L, Uversky VN (2013) Resilience of death: intrinsic disorder in proteins involved in the programmed cell death. Cell Death Differ 20:1257–1267. https://doi.org/10.1038/cdd.2013.65
Wang J, Ge P, Lei Z, Lu Z, Qiang L, Chai Q, Zhang Y, Zhao D, Li B, Su J, Peng R, Pang Y, Shi Y, Zhang Y, Gao GF, Qiu X, Liu CH (2021) Mycobacterium tuberculosis protein kinase G acts as an unusual ubiquitinating enzyme to impair host immunity. EMBO Rep 22:e52175. https://doi.org/https://doi.org/10.15252/embr.202052175
Lucattini R, Likić VA, Lithgow T (2004) Bacterial Proteins Predisposed for Targeting to Mitochondria. Mol Biol Evol 21:652–658. https://doi.org/10.1093/molbev/msh058
Grover S, Sharma T, Singh Y, Kohli S, Singh MPA, Semmler T, Wieler LH, Tedin K, Ehtesham NZ, Hasnain SE (2018) The PGRS Domain of Mycobacterium tuberculosis PE_PGRS Protein Rv0297 Is Involved in Endoplasmic Reticulum Stress-Mediated Apoptosis through Toll-Like Receptor 4., MBio. 9 https://doi.org/10.1128/mBio.01017-18
Cadieux N, Parra M, Cohen H, Maric D, Morris SL, Brennan MJ (2011) Induction of cell death after localization to the host cell mitochondria by the Mycobacterium tuberculosis PE-PGRS33 protein. Microbiology 157:793–804. https://doi.org/10.1099/mic.0.041996-0
Sharma N, Shariq M, Quadir N, Singh J, Sheikh JA, Hasnain SE, Ehtesham NZ (2021) Mycobacterium tuberculosis Protein PE6 (Rv0335c), a Novel TLR4 Agonist, Evokes an Inflammatory Response and Modulates the Cell Death Pathways in Macrophages to Enhance Intracellular Survival. Front Immunol 12:696491. https://doi.org/10.3389/fimmu.2021.696491
Priyanka, Medha P, Bhatt H, Joshi S, Sharma M, Sharma (2023) Late stage specific Rv0109 (PE_PGRS1) protein of Mycobacterium tuberculosis induces mitochondria mediated macrophage apoptosis. Microb Pathog 176:106021. https://doi.org/10.1016/j.micpath.2023.106021
Martin M, DeVisch A, Boudehen Y-M, Barthe P, Turapov O, Aydogan T, Heriaud L, Gracy J, Mukamolova GV, Letourneur F, Cohen-Gonsaud M (2021) A Mycobacterium tuberculosis effector targets mitochondrion, controls energy metabolism and limits cytochrome c exit, BioRxiv. 2021.01.31.428746. https://doi.org/10.1101/2021.01.31.428746
Duan L, Gan H, Golan DE, Remold HG (2002) Critical Role of Mitochondrial Damage in Determining Outcome of Macrophage Infection with Mycobacterium tuberculosis. J Immunol 169:5181–5187. https://doi.org/10.4049/jimmunol.169.9.5181
Jamwal S, Midha MK, Verma HN, Basu A, Rao KVS, Manivel V (2013) Characterizing virulence-specific perturbations in the mitochondrial function of macrophages infected with Mycobacterium tuberculosis. Sci Rep 3. https://doi.org/10.1038/srep01328
Lorenzo HK, Susin SA (2004) Mitochondrial effectors in caspase-independent cell death. FEBS Lett 557:14–20. https://doi.org/10.1016/s0014-5793(03)01464-9
Zorov DB, Juhaszova M, Sollott SJ (2014) Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS release. Physiol Rev 94:909–950. https://doi.org/10.1152/physrev.00026.2013
Zhu Y, Wan C, Lin J, Hammes H (2022) Mitochondrial Oxidative Stress and Cell Death in Podocytopathies
Green DR, Kroemer G (2004) The pathophysiology of mitochondrial cell death. Science 305:626–629. https://doi.org/10.1126/science.1099320
Medha, Priyanka S, Sharma M, Sharma (2023) PE_PGRS45 (Rv2615c) protein of Mycobacterium tuberculosis perturbs mitochondria of macrophages. Immunol Cell Biol. https://doi.org/10.1111/imcb.12677
Mossmann D, Meisinger C, Vögtle F-N (2012) Processing of mitochondrial presequences. Biochim Biophys Acta 1819:1098–1106. https://doi.org/10.1016/j.bbagrm.2011.11.007
Davis JM, Ramakrishnan L (2009) The role of the granuloma in expansion and dissemination of early tuberculous infection. Cell 136:37–49. https://doi.org/10.1016/j.cell.2008.11.014
Daniel J, Kapoor N, Sirakova T, Sinha R, Kolattukudy P (2016) The perilipin-like PPE15 protein in Mycobacterium tuberculosis is required for triacylglycerol accumulation under dormancy-inducing conditions. Mol Microbiol 101:784–794. https://doi.org/10.1111/mmi.13422
Paysan-Lafosse T, Blum M, Chuguransky S, Grego T, Pinto BL, Salazar GA, Bileschi ML, Bork P, Bridge A, Colwell L, Gough J, Haft DH, Letunić I, Marchler-Bauer A, Mi H, Natale DA, Orengo CA, Pandurangan AP, Rivoire C, Sigrist CJA, Sillitoe I, Thanki N, Thomas PD, Tosatto SCE, Wu CH, Bateman A (2023) Nucleic Acids Res 51:D418–D427 InterPro in 2022. https://doi.org/10.1093/nar/gkac993
Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680. https://doi.org/10.1093/nar/22.22.4673
Qian J, Chen R, Wang H, Zhang X (2020) Role of the PE/PPE Family in Host-Pathogen Interactions and Prospects for Anti-Tuberculosis Vaccine and Diagnostic Tool Design. Front Cell Infect Microbiol 10:594288. https://doi.org/10.3389/fcimb.2020.594288
Danelishvili L, Everman J, Bermudez LE Mycobacterium tuberculosis PPE68 and Rv2626c genes contribute to the host cell necrosis and bacterial escape from macrophages. Virulence 7 (2016) 23–32. https://doi.org/10.1080/21505594.2015.1102832
Joseph S, Yuen A, Singh V, Hmama Z (2017) Mycobacterium tuberculosis Cpn60.2 (GroEL2) blocks macrophage apoptosis via interaction with mitochondrial mortalin. Biol Open 6:481–488. https://doi.org/10.1242/bio.023119
Dubey RK, Dhamija E, Kumar Mishra A, Soam D, Mohanrao Yabaji S, Srivastava K, Srivastava KK (2021) Mycobacterial origin protein Rv0674 localizes into mitochondria, interacts with D-loop and regulates OXPHOS for intracellular persistence of Mycobacterium tuberculosis. Mitochondrion 57:241–256. https://doi.org/10.1016/j.mito.2020.11.014
Wang C, Youle RJ (2009) The role of mitochondria in apoptosis*. Annu Rev Genet 43:95–118. https://doi.org/10.1146/annurev-genet-102108-134850
Kruh NA, Troudt J, Izzo A, Prenni J, Dobos KM (2010) Portrait of a Pathogen: The Mycobacterium tuberculosis Proteome In Vivo. PLoS ONE 5:e13938
Murphy DJ, Brown JR (2007) Identification of gene targets against dormant phase Mycobacterium tuberculosis infections. BMC Infect Dis 7:84. https://doi.org/10.1186/1471-2334-7-84
Gillies LA, Kuwana T (2014) Apoptosis regulation at the mitochondrial outer membrane. J Cell Biochem 115:632–640. https://doi.org/10.1002/jcb.24709
Mohareer K, Medikonda J, Vadankula GR (2020) Mycobacterial Control of Host Mitochondria: Bioenergetic and Metabolic Changes Shaping Cell Fate and Infection Outcome. 10. https://doi.org/10.3389/fcimb.2020.00457
Sohn H, Kim JS, Shin SJ, Kim K, Won CJ, Kim WS, Min KN, Choi HG, Lee JC, Park JK, Kim HJ (2011) Targeting of Mycobacterium tuberculosis heparin-binding hemagglutinin to mitochondria in macrophages. PLoS Pathog 7:1–17. https://doi.org/10.1371/journal.ppat.1002435
Sánchez A, Espinosa P, García T, Mancilla R (2012) (2012) The 19 kDa mycobacterium tuberculosis lipoprotein (lpqh) induces macrophage apoptosis through extrinsic and intrinsic pathways: A role for the mitochondrial apoptosis-inducing factor, Clin. Dev. Immunol. https://doi.org/10.1155/2012/950503
Lee K, Choi S, Choi H, Gurmessa S (2020) Recombinant Rv3261 protein of Mycobacterium tuberculosis induces apoptosis through a mitochondrion-dependent pathway in macrophages and inhibits intracellular bacterial growth. Cell Immunol 354:104145. https://doi.org/10.1016/j.cellimm.2020.104145
Aguiló N, Uranga S, Marinova D, Martín C, Pardo J (2014) Bim is a crucial regulator of apoptosis induced by Mycobacterium tuberculosis. Cell Death Dis 5:e1343. https://doi.org/10.1038/cddis.2014.313
Ahmed A, Dolasia K, Mukhopadhyay S (2018) Mycobacterium tuberculosis PPE18 Protein Reduces Inflammation and Increases Survival in Animal Model of Sepsis. J Immunol 200:3587–3598. https://doi.org/10.4049/jimmunol.1602065
Deng W, Yang W, Zeng J, Abdalla AE, Xie J (2016) Mycobacterium tuberculosis PPE32 promotes cytokines production and host cell apoptosis through caspase cascade accompanying with enhanced ER stress response. Oncotarget 7:67347–67359. https://doi.org/10.18632/oncotarget.12030
Daim S, Kawamura I, Tsuchiya K, Hara H, Kurenuma T, Shen Y, Dewamitta SR, Sakai S, Nomura T, Qu H, Mitsuyama M (2011) Expression of the Mycobacterium tuberculosis PPE37 protein in Mycobacterium smegmatis induces low tumour necrosis factor alpha and interleukin 6 production in murine macrophages. J Med Microbiol 60:582–591. https://doi.org/10.1099/jmm.0.026047-0
Akira S (2009) Pathogen recognition by innate immunity and its signaling., Proc. Jpn. Acad. Ser. B. Phys. Biol. Sci. 85 143–156. https://doi.org/10.2183/pjab.85.143
Harding CV, Boom WH (2010) Regulation of antigen presentation by Mycobacterium tuberculosis: a role for Toll-like receptors. Nat Rev Microbiol 8:296–307. https://doi.org/10.1038/nrmicro2321
Brennan MJ (2017) The Enigmatic PE/PPE Multigene Family of Mycobacteria and Tuberculosis Vaccination. Infect Immun 85:e00969–e00916. https://doi.org/10.1128/IAI.00969-16
Sharma T, Grover S, Arora N, P M, Ehtesham NZ, Hasnain SE (2020) PGRS Domain of Rv0297 of Mycobacterium tuberculosis Is Involved in Modulation of Macrophage Functions to Favor Bacterial Persistence. Front Cell Infect Microbiol 10:451. https://doi.org/10.3389/fcimb.2020.00451
Tiwari B, Ramakrishnan UM, Raghunand TR (2015) The Mycobacterium tuberculosis protein pair PE9 (Rv1088)-PE10 (Rv1089) forms heterodimers and induces macrophage apoptosis through Toll-like receptor 4. Cell Microbiol 17:1653–1669. https://doi.org/10.1111/cmi.12462

No competing interests reported.

Supplementarydata.docx

Download PDF

Journal Publication

published 14 Apr, 2024

Read the published version in Apoptosis →

Editorial decision: Revision requested
17 Mar, 2024
Reviews received at journal
19 Feb, 2024
Reviewers agreed at journal
12 Feb, 2024
Reviewers invited by journal
11 Feb, 2024
Editor assigned by journal
01 Feb, 2024
Submission checks completed at journal
01 Feb, 2024
First submitted to journal
30 Jan, 2024

You are reading this latest preprint version

C-terminal region of Rv1039c (PPE15) protein of Mycobacterium tuberculosis targets host mitochondria to induce macrophage apoptosis

Status:

Journal Publication

Version 1

Abstract

Figures

INTRODUCTION

MATERIALS AND METHODS

1. Prediction of C-terminal region of Rv1039c and multiple sequence alignment with mitochondria-targeting pro-apoptotic proteins

2. Cloning, expression and purification of Rv1039c and Rv1039c-/-Cterm recombinant proteins and construction of knock-in M. smegmatis

3. Culture of THP1 macrophages

3.1 Cell Titer Blue assay for cell viability

4. Localization of Rv1039c and Rv1039c-/-Cterm proteins in host cell mitochondria and their impact on mitochondrial perturbations

4.1 In-silico prediction for mitochondrial localization of Rv1039c

4.2 Mitochondrial localization of Rv1039c and Rv1039c-/-Cterm through confocal microscopy

4.3 Detection of alterations in MMP and generation of superoxides

4.4 Alterations in intracellular ADP/ATP ratio

5. Determination of apoptosis inducing potential of Rv1039c and Rv1039c-/-Cterm

5.1 LDH release assay

5.2 AnnexinV/PI assay

5.3 TUNEL assay

5.4 Expression levels of pro-apoptotic and anti-apoptotic factors

GAPDH: FP: AAGGGCATCCTGGGCTACAC; RP: GTCCACCACCCTGTTGCTGTAG

5.5 Release of Cytochrome-C by Rv1039c and Rv1039c-/-Cterm

5.6 Activation of Caspases by Rv1039c and Rv1039c-/-Cterm

6. Modulation of host immune response by Rv1039c

6.1 Interaction of Rv1039c with TLRs through docking studies

6.2 Dot blot binding assay to study the interaction of Rv1039c with TLR2 and TLR4

6.3 Detection of expression profile of TLRs in response to Rv1039c and Rv1039c-/-Cterm

6.4 Expression levels of HLA-DR in response to Rv1039c and Rv1039c-/-Cterm

6.5 Expression of effector molecule NF-κB and estimation of levels of pro-inflammatory cytokines

Statistical analysis

RESULTS

1. Defining the C-terminal region of Rv1039c

2. Cloning, expression and purification of Rv1039c and Rv1039c-/-Cterm recombinant proteins and construction of knock-in M. smegmatis

3. C‑terminal region of Rv1039c protein induces cell death of THP1 macrophages

4. Rv1039c localizes to host mitochondria and induces mitochondrial perturbations

4.1 Localization of Rv1039c and Rv1039c-/-Cterm proteins in host cell mitochondria

4.2 C-terminal region of Rv1039c alters the MMP and produces mitochondrial superoxides in THP1 macrophages

4.3 C-terminal region of Rv1039c disturbs the ADP/ATP ratio

5. Role of C-terminal region of Rv1039c in inducing macrophage apoptosis

5.1 C-terminal region of Rv1039c induces apoptotic cell death in host macrophages

5.2 C-terminal region of Rv1039c upregulates the expression levels of pro-apoptotic genes

5.3 C-terminal region of Rv1039c induces caspase mediated apoptosis

5.4 C-terminal region of Rv1039c induces release of Cytochrome C

6. C-terminal region of Rv1039c modulates the host immune response by interacting with TLR4

6.1 Rv1039c interacts with TLR4

6.2 Rv1039c upregulates the surface expression of TLR4 and HLA-DR on THP1 macrophages

6.3 C-terminal region of Rv1039c upregulates expression of effector molecule NF-κB and cytokine profiles of TNF-α and IL-1β

DISCUSSION

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1