Insulin glargine production: Codon engineering in Pichia pastoris X-33 for enhanced therapeutic yield

doi:10.21203/rs.3.rs-8189748/v1

Download PDF

Research Article

Insulin glargine production: Codon engineering in Pichia pastoris X-33 for enhanced therapeutic yield

https://doi.org/10.21203/rs.3.rs-8189748/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Aims

This study aims to investigate the optimization and expression of insulin glargine, a long-acting insulin analogue, in Pichia pastoris X-33. The focus is on enhancing the production efficiency of recombinant insulin glargine by utilizing codon optimization to increase protein yield.

Materials and methods

The insulin glargine gene was codon-optimized to enhance translational efficiency. Both the codon-optimized and non-optimized versions of the gene were introduced into Pichia pastoris X-33 via transformation with the pPICZalpha-G plasmid. Gene expression was induced using methanol-driven fermentation in ½ BSM. Protein production was evaluated through sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) to identify protein bands characteristic of insulin glargine. Subsequent purification was achieved through High-Performance Liquid Chromatography (HPLC) to confirm the successful production of insulin glargine.

Results

The expression of both the codon-optimized and non-optimized insulin glargine genes in P. pastoris X-33 was successful, with the optimized gene yielding significantly higher quantities of insulin glargine protein. Characteristic proteins corresponding to insulin glargine were observed, validating gene expression.

Conclusion

This study demonstrates the codon optimization significantly boosting protein yields of insulin glargine. The findings pave the way for further optimization of fermentation techniques and progress towards clinical-scale production of therapeutic insulin glargine for diabetes treatment.

Biotechnology and Bioengineering

Applied Biochemistry

Developmental Biology

Pichia pastoris

X33

Codon optimization

insulin glargine

recombinant protein

The production of recombinant proteins has become a cornerstone of modern biotechnology, enabling the large-scale synthesis of therapeutic proteins. Insulin glargine, a long-acting insulin analogue, is one such therapeutic protein that requires efficient production systems to meet clinical demands (Wang et al., 2003) (Wang et al., 2003). One promising host for recombinant protein production is Pichia pastoris, a methylotrophic yeast known for its high expression levels, ease of genetic manipulation, and ability to perform post-translational modifications similar to higher eukaryotes (Cereghino and Cregg, 2000; Macauley-Patrick et al., 2005).

Despite these advantages, the expression of heterologous genes in P. pastoris can be hampered by differences in codon usage between the host and the target gene, potentially leading to reduced translation efficiency and lower protein yields (Gustafsson et al., 2004). Codon optimization, which involves modifying the DNA sequence of a gene to match the preferred codon usage of the expression host, has emerged as a crucial strategy to enhance the expression of recombinant proteins (Menzella, 2011; Quax et al., 2015; Yu et al., 2013).

Pichia pastoris strain X-33 is particularly well-suited for the production of insulin glargine. This strain combines the advantages of high growth rates and robust protein expression systems, making it a valuable tool for industrial applications (Cregg et al., 2009). The expression of insulin glargine in P. pastoris X-33 not only leverages the yeast's efficient protein production capabilities but also benefits from its capacity to perform human-like glycosylation (Martinet et al., 1998), which is essential for the biological activity of many therapeutic proteins.

Insulin glargine is essential for maintaining normal glucose homeostasis and is therefore valuable in treating diabetes. Insulin glargine comprises two polypeptide chains, A (21 amino acids: Gly-Ile-Val-Glu-Gln-Cys-Cys-Thr-Ser-Ile-Cys-Ser-Leu-Tyr-Gln-Leu-Glu-Asn-Tyr-Cys-Gly) and B (32 amino acids: Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val-Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe-Phe-Tyr-Thr-Pro-Lys-Thr-Arg-Arg), connected by three disulfide bonds (Hwang et al., 2016; McKeage and Goa, 2012; Thevis et al., 2005). In comparing human insulin, several key differences arise, particularly in their structural and pharmacokinetic characteristics. Human insulin, consisting of two chains (A and B), is effective but requires frequent daily injections due to its shorter duration of action. In contrast, insulin glargine, a long-acting analog developed using recombinant DNA technology, differs in structure by having a modified A-chain (replacement of asparagine with glycine at position A21) and two added arginine residues at the B-chain's end. These modifications allow insulin glargine to form micro-precipitates when injected, releasing insulin slowly and providing stable, long-lasting glucose control with fewer injections (Owens, 2002; Yadav and Parakh, 2006). This improved pharmacokinetic profile has made insulin glargine particularly advantageous for managing diabetes over long periods. As diabetes prevalence increases globally, the demand for insulin glargine is projected to rise substantially due to its convenience and better glycemic control.

This study explores the codon optimization and expression of insulin glargine in P. pastoris X-33, aiming to develop an efficient system for producing this vital therapeutic protein. The sequences propose to improve translational performance; to increase the efficiency of translational initiation and to increase the efficiency of translational termination. By optimizing the codon usage and employing advanced genetic engineering techniques, this research seeks to enhance the yield and quality of insulin glargine, ultimately contributing to more effective diabetes management therapies.

2.1. Codon optimization of Insulin glargine Precursor gene (IP glargine).

The IP gene was optimized for expression in P. pastoris using OptimumGene™ codon optimization analysis. This process considered various parameters, such as codon usage bias, GC content, CpG dinucleotide content, mRNA secondary structure, cryptic splicing sites, premature PolyA sites, internal chi sites, ribosomal binding sites, negative CpG islands, RNA instability motifs (ARE), repeat sequences (direct, reverse, and Dyad repeats), and restriction sites that could hinder cloning. The nucleotide sequences of the original/non optimized (NO) and optimized (OP) artificially synthesized glargine genes were ACCCGACGATTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCT ACCTAGTGTGCGGGGAACGAGGCTTCT TCTACACACCCAAGACCCGACGAGGCATT GTGGAACAATGCTGTACCAGCATCTGCTCC CTCTACCAGCTGGAGAACTACTGCGGCTAA and ACTAGAAGATTTGTTAATCAGCATTTGTGCG GAAGTCATTTGGTTGAGGCATTGTATTTGGTTTGTGGAGAGAGAGGTTTCTTTTATACTCCAAAGACT AGAAGAGGTATTGTTGAGCAGTGTTGTACTT CTATCTGTTCATTGTATCAGTTGGAAAATTAT TGCGGTTAG, respectively.

2.2. Transformation pPICZalpha-IP-glargine in E. coli Top10.

To facilitate the conversion of P. pastoris X-33, the pPICZalpha-G plasmid was initially transformed into E. coli Top10 via the calcium chloride heat shock method [1]. For plasmid insertion, E.coli Top10 competent cells and plasmid were first placed on ice for 30 minutes. Following this, E. coli Top10 cells along with the plasmid were subjected to a heat shock at 42°C for 45 seconds and subsequently returned to ice for 5 minutes and added 1 ml of SOC medium. The cells were then incubated in a shaker at 37°C and 200 rpm for 2 hours. Post-incubation, the E. coli Top10 cells were inoculation on Low-Salt Luria Bertani agar plate (LS-LB) contain zeocin 25 µg/ml then incubated overnight at 37°C.

2.3. Isolation of Plasmid

50 ml (using flask 250 ml) bacterial culture was inoculated in LS-LB (Low Salt-Luria Bertani) and incubated at 37°C with shaker at 200 rpm overnight. The bacterial culture was transferred into a 50 ml sterile tube and centrifuged at 4000xg at 4°C for 10 minutes. The supernatant was discarded, and the pellet was resuspended in 2 ml of PD1 buffer (resuspenion) with 10 µg/ml RNase (Presto™ Mini Plasmid Kit from Geneaid). Subsequently, 2 ml of PD2 buffer (cell lysis) was added to the bacterial suspension, and the tube was inverted 6 times. Incubated in 3 minute at room temperature. Thereafter, 2 ml of PD3 buffer (neutralization) was added, and the tube was inverted 10 times. The bacterial lysate was centrifuged at 13,200xg at room temperature for 10 minutes. The supernatants were then collected into a 15 ml tube while the pellets were discarded. 5 ml of 96% ethanol was added to the supernatant and mixed thoroughly for 5 seconds. The ethanol-sample mixture was loaded onto 4 spin columns and centrifugated at 13,200xg for 30 seconds. After each spin, the flow-through was discarded. These procedures were repeated until the entire sample had been processed through the spin columns. The columns were then washed with 500 µl of wash buffer and centrifugated at 13,200xg at room temperature for 30 seconds, and the flow-through was discarded. The empty columns were centrifuged at 13,200xg at room temperature for 2 minutes to eliminate any residual wash buffer. The old collection tubes were discarded, and each column was placed into 1.5 ml sterile tube. Subsequently, 35 µl of Nuclease Free Water was added to each column (Preheat at 65°C before used), which was then incubated for 2 minutes at room temperature. Centrifuged at 13,200xg for 2 minutes to elute the Plasmid (Pronobis et al., 2016). After measuring the Plasmid concentration, the samples were stored at -20°C for further use. Additionally, sequencing procedures were conducted.

2.4. Linearization with SacI enzyme.

Linearization refers to the conversion of circular plasmids into linear forms. After extracting the plasmid, the next step involves its linearization using the SacI enzyme (Thermo). The reaction mixture consists of 1 µl of Nuclease-Free Water (NFW), 4 µl of 10x buffer, 33 µl of plasmid, and 2 µl of SacI enzyme. The mixture is incubated in a thermal cycler at 37°C for 2 hours, followed by enzyme inactivation at 75°C for 20 minutes. The verification of the mixture was performed on 1% agarose gel with GreenSafe Premium (nzytech).

2.5. Transformation pPICZalpha-G in Pichia pastoris X33

The linearized and concentrated pPICZα DNA containing insert of codon non-optimization and codon optimization were transformed into P. pastoris X33 strain using an electroporator (Gene Pulser Xcell electroporation from Bio-Rad). The transformation procedure was carried out following the EasySelect™ Pichia Expression Kit manual (Invitrogen). Approximately 5–10 µg of plasmid containing non-optimized codons, linearized with SacI, was mixed with competent Pichia cells, as well as the optimized codon plasmid. The 2 mm cuvettes containing the plasmid and competent cells were incubated on ice for 5 minutes, then pulsed with 1500 V, 200 Ω and 25 and 50 µF. Immediately, 1 ml of cold sorbitol was added (up and down) and transferred into a sterile 15 ml Falcon tube. Incubate for 1 hour and 30 minutes without shaking to recover the electroporated cells, then add 1 ml of sterile YPD and incubate again with shaking at 30°C and 200 rpm for 1 hour. Subsequently, 200 µl of the incubation mixture was pipetted onto a YPDS plate containing 100 µg/ml zeocin and incubated for 5 day.

2.6. DNA Amplification of the IP-glargine genes in the Pichia pastoris genome

DNA amplification via PCR was conducted using the Promega Gotaq Green Master Mix according to the manufacturer's instructions. The amplification of DNA from X33 transformants was performed in a final volume of 25 µl, which included 12.5 µl of the enzyme mix, 4.5 µl of deionized water (ddH2O), 2 µl each of forward and reverse primers, and 4 µl of the DNA sample. The sequences of the primers are F: 5'-GACTGGTTCCAATTGACAAGC-3' and R: 5'-GCAAATGGCATTCTGACATCC-3'. The PCR amplification conditions were set as follows: denaturation at 95°C for one minute, annealing at 55°C for AOX1 and Origin, and 56°C for the Optimized, followed by an extension at 72°C for one minute, repeated for 30 cycles. The PCR products for AOX1, OP, and NO were analyzed by running on 1% and 2% agarose gels, respectively, and visualized using a gel documentation system. Furthermore sequencing processes was carried out.

2.7. Culture condition of IP-glargine production

The Yeast Extract Peptone Dextrose (YPD) for the vegetative phase contained 1% yeast extract, 2% peptone, 2% Dextrose (pH 6) and added zeocin. The temperature was maintained at 30°C, with shaking at 230 rpm for 24 hours. Before proceeding to the fermentation phase, the YPD cultures in 6 flasks (NO 3 flasks, OP 3 flasks) were harvested by centrifugation at 5000 rpm for 3 minutes. The pellet was then used for the production of IP glargine using ½ BSM medium containing phosphoric acid 85%, calcium sulfate, potassium sulfate, potassium hydroxide, magnesium sulfate, ammonium sulfate, glycerol, and PTM1 (cupric sulfate, sodium iodide, manganese sulfate, sodium molybdate, boric acid, cobalt chloride, zinc chloride, ferrous sulfate, biotin, and sulfuric acid). Additionally, vitamins (calcium pantothenate, myo-inositol, thiamine dichloride, pyridoxine hydrochloride, nicotinic acid, biotin, and potassium hydrogen phosphate), and zeocin. The medium was adjusted with NH3 12% (pH 5). The ½ BSM cultures were incubated 24 hours before methanol added. Methanol was added every 24 hours to a final concentration of 2% v/v (0, 24, 48, and 72 hours). Cultures were then incubated at 30°C and 250 rpm then the culture samples were measured for optical density (OD) at 600 nm.

2.8. Protein analysis

The culture broth was mixed with loading buffer (tris HCl, dithiothreitol, SDS, bromophenol blue, glycerol, β-mercaptoethanol) in a 4:1 ratio respectively, and incubated at 37°C for 5 minutes. The mixture was then run on a tricine gel (Schägger, 2006). The gel was prepared in three solutions: separating, spacer, and stacking. Then, 20 µl of the sample was loaded per well and run at 30 volts for 60 minutes, followed by 90 volts for 60 minutes (conditionally). Gel staining was performed using Coomassie blue. If the bands were not visible, silver staining was subsequently applied.

2.9. Cation Exchange Chromatography

The culture supernatant derived from flask production was first centrifuged at 5000 rpm for 5 minutes, followed by filtration through a 0.45 µm sterile filter. The filtered supernatant was then diluted in an equilibrium buffer (20 mM sodium acetate, pH 4.0 adjusted with HCl). The second filtration step was performed using a vacuum pump. The purification procedure involved sequential steps, including equilibrium, activation, and washing. Upon completing these steps, the sample was applied to a HiTrap SP-FF column (5 ml resin). After completed the sample, the equilibrium buffer was run in resin followed by elution. The elution process consisted of two stages: the first stage involved 20 mM sodium acetate (pH 4.0) with 50% ethanol (v/v), and the second stage involved 20 mM sodium acetate (pH 4.0) with 50% ethanol (v/v) and 500 mM NaCl. Each performed for 5 column volumes at a flow rate of 5 ml/min.

2.10. Reversed-Phase High-Performance Liquid Chromatography (RP-HPLC) Analysis

Recombinant insulin glargine concentrations for the cell-free culture media from the shake flask cultures (96-h induction in methanol) were determined by RP-HPLC. Samples were injected into the HPLC system (Waters Alliance 2695 Chromatograph) equipped with an Ultrasphere symmetry300™ C4 5µm (4.6 × 250 mm column) and a UV detector at 220 nm. A gradient elution with mobile phase A (0.1% trifluoracetic acid, TFA, in water) and mobile phase B (0.1% TFA in acetonitrile) was used (0 to 6 min, 0 to 20% B; 6 to 32 min, 20 to 46% B; 32 to 35 min, 46 to 0% B) at a flow rate of 1 mL/min and 25°C. Lontus Solostar 100 IU/mL insulin glargine was used as the standard for retention time reference.

The construct containing the origin/non optimized (NO) and codon-optimized (OP) sequence of insulin glargine, a long-acting insulin analogue, was successfully expressed in P. pastoris X-33 using ½ BSM media. The integrity of all constructs was rigorously validated through sequencing, and the results of plasmid transformation in E. coli and P. pastoris X33 were subsequently confirmed.

3.1. Integrated pPICZa-G in Escherichia coli

The Fig. 1.a and 1.b illustrates the sequence alignment results of the pPICZa-G transformation in E. coli. The sequences shown are nucleotide alignments labelled as A and B. These alignments offering insights into the efficiency of gene synthesis and plasmid integration.

Prior to transformation, after the plasmid was confirmed by sequencing, it was linearized using the SacI enzyme to improve the efficiency of DNA integration into the genome of P. pastoris X33. The extraction and linearization results were analyzed on a 1% agarose gel. The linearized pPICZα-G plasmid had an approximate size of 3,800 bp (Fig. 2)

Figure 2. Plasmid and linearization result. (1&2) Plasmid linearization, (3&4) Plasmid before linearization, (5) Ladder 1 kb.

3.2. Integrated pPICZa-G into Pichia pastoris X33 genome.

The results of the OP and NO transformations indicate variations in colony formation between the two treatmensts. The OP plate demonstrated a lower number of colonies, whereas the NO plate showed a higher colony count. These differences are likely attributable to variations in the transformation conditions, particularly the pulse method employed (OP at 25 µF and NO at 50 µF), which appears to have affected the observed outcomes.

The transformation results were cultured again on YPD medium supplemented with zeocin at a concentration of 100 µg/ml (Fig. 3), followed by DNA extraction and PCR analysis using the AOX1 primer. The PCR results indicated the presence of several bands. The band detected around 2.2 kb corresponds to the AOX1 gene, while the target band for insulin glargine is located at approximately 750 bp (Fig. 4).

The PCR products exhibiting a target band of approximately 759 bp were sent for sequencing analysis. The sequencing results from IP-glargine genes in the P. pastoris genome are presented in Fig. 5.

3.3. Production of glargine in ½ BSM culture

After the sequencing was conducted and validated for consistency, the colonies were regenerated and subsequently processed for fermentation in ½ BSM medium supplemented with PTM1 and vitamins. The fermentation process was conducted for 96 hours, with the addition of 2% methanol every 24 hours. Following the 96-hour period, harvesting was performed, and the pellet and supernatant were separated. The supernatant was collected for analysis of insulin glargine.

The analysis of the culture supernatants from the NO and OP samples between 0 and 96 hours exhibited similar profiles on the tricine SDS-PAGE gel. Protein bands began to appear at 48 hours post methanol induction, with increasing band intensity observed at 72 and 96 hours, indicating protein expression or accumulation throughout the fermentation process. Notably, insulin glargine protein bands were detected around 7.5 kDa and 10 kDa (Fig. 6.A). The culture supernatant was then purified, as shown in the band profiles in Fig. 6.B, where the OP sample presented thicker bands compared to the NO sample.

The purification method utilized in this study is cation exchange chromatography, a widely adopted technique known for its numerous advantages, such as high yield and efficient recovery. In this research, a HiTrap SP-FF column was employed for the purification of the insulin glargine precursor.

The chromatogram below illustrates retention time (RT) data obtained from High-Performance Liquid Chromatography (HPLC) analysis of a sample collected at 96 hours of fermentation. The standard insulin glargine exhibited a sharp, well-defined peak at RT 21.071, signifying high purity and serving as a reference for comparison. In contrast, the NO and OP samples displayed broader and lower peaks at RT 19.732 and 19.661, respectively, indicating reduced purity and concentration. The concentration of the standard was 1 IU/ml, NO sample was 0.01 IU/ml and the OP was 0.14 IU/ml.

This study successfully demonstrates the expression of both the codon-optimized (OP) and non-optimized (NO) insulin glargine gene constructs using the pPICZα vector in Pichia pastoris X-33. The plasmid constructs were validated through sequencing, which confirmed the accurate synthesis and integration into the vectors (Fig. 1a and 1b). After the constructs were confirmed, they were linearized using SacI, resulting in a fragment of approximately 3.800 kb, as observed in agarose gel electrophoresis (Fig. 2). This step was crucial for facilitating homologous recombination, ensuring stable and efficient integration into the yeast genome (Karbalaei et al., 2020; Li et al., 2007). This setup allowed for subsequent successful transformation into P. pastoris.

The successful integration of the insulin glargine gene into the yeast genome was confirmed through PCR analysis using the AOX1 primer. Both the OP and NO constructs exhibited the expected 759 bp band (Fig. 4), which, along with sequencing results (Fig. 5a and 5b), validated the accurate incorporation and structural integrity of the constructs within the genome. This step established the readiness of the system for protein expression.

Upon successful transformation, insulin glargine expression was induced in ½ BSM medium using methanol as the inducer. In P. pastoris systems, methanol is commonly employed to activate the AOX1 promoter, which drives gene expression under methanol-utilizing conditions (Daly and Hearn, 2005). The silver staining results after 96 hours of fermentation (Fig. 6) revealed protein bands corresponding to insulin glargine, with molecular weights of approximately 7.5 kDa and 10 kDa. These bands were consistent with reported proinsulin (Feizi et al., 2020; Kaki et al., 2022; Nurdiani et al., 2024, 2022). The progressive appearance and increasing intensity of these bands over time indicate the accumulation of insulin glargine, with notable expression observed after 48 hours.

Pichia pastoris is recognized as a highly effective model organism for the production of recombinant proteins due to its superior secretory capabilities compared to Saccharomyces cerevisiae (Ahmad et al., 2014). As a methylotrophic yeast, P. pastoris offers several advantages, including the ability to perform post-translational modifications that closely mimic those of higher eukaryotic systems (Daly and Hearn, 2005; Puxbaum et al., 2015). These modifications such as glycosylation, disulfide bond formation, and proteolytic processing—are essential for the proper functionality of therapeutic proteins (Ahmad et al., 2014; Cereghino and Cregg, 2000). Additionally, P. pastoris exhibits a higher capacity for secreting heterologous proteins than S. cerevisiae, making it particularly advantageous for industrial applications like insulin glargine production (Macauley-Patrick et al., 2005). This increased capacity is attributed to the yeast's highly efficient protein folding and processing systems in the endoplasmic reticulum and Golgi apparatus (Barlowe and Miller, 2013; Delic et al., 2013). Thus, P. pastoris serves not only as a reliable platform for recombinant protein production but also as an important model for studying eukaryotic cell secretion mechanisms (Cereghino and Cregg, 2000; Daly and Hearn, 2005).

One significant advantage of using P. pastoris for insulin glargine production is its capacity to perform post-translational modifications essential for the biological activity of therapeutic proteins. This yeast can produce glycosylation patterns similar to those in humans, which are critical for the stability and functionality of insulin analogues (Cereghino and Cregg, 2000). Our results underscore the efficacy of P. pastoris X-33 as a host for insulin glargine production.

Additionally, P. pastoris X-33 is highly suitable for industrial applications due to its scalability, high growth rate, and robust protein expression capabilities. These characteristics align with the findings of Macauley-Patrick et al, who highlighted the benefits of P. pastoris in large-scale recombinant protein production (Macauley-Patrick et al., 2005). Furthermore, P. pastoris is amenable to genetic manipulation, allowing for further optimization of expression systems to enhance yield and protein quality.

Codon usage bias refers to the non-random selection of synonymous codons, where different codons that encode the same amino acid vary in their translation efficiency (Brandis and Hughes, 2016; Novoa and Ribas de Pouplana, 2012). Codon optimization has been widely recognized as an effective strategy for improving heterologous gene expression by aligning codon usage with the host's tRNA pool, thereby enhancing translation efficiency and proper protein folding (Gustafsson et al., 2012, 2004; Mauro and Chappell, 2014; Menzella, 2011). In our study, codon optimization led to a substantial increase in protein yield, confirming its practical benefits for insulin glargine synthesis.

In P. pastoris, codon usage bias can significantly impact gene expression due to differences in the preferred codons between the yeast and the source organism of the gene. Non-adapted genes may face challenges in achieving optimal expression. Addressing this, codon optimization modifies the gene's codons to align with the host's preferences without altering the amino acid sequence. This adjustment enhances mRNA translation efficiency and stability, reduces ribosomal stalling, and improves protein folding, all of which contribute to higher yields of functional protein (Sinclair and Choy, 2002). Additionally, proper protein folding minimizes the accumulation of misfolded proteins and reduces the activation of stress pathways, such as the unfolded protein response (UPR), ultimately lowering the metabolic burden on the host cells (Wong et al., 2018).

This study successfully highlights the potential of codon optimization as a method for enhancing the production efficiency of insulin glargine. This demonstrates that codon optimization is an effective strategy to boost the yield and efficiency of recombinant protein production, particularly in yeast expression systems, thereby offering a promising approach for industrial-scale production of insulin analogues. Future research should focus on optimizing the fermentation process, improving protein purification methods, and scaling up production to meet the growing clinical demand for insulin glargine in diabetes management.

Acknowledgements

I would like to express gratitude to the laboratory staff, whose invaluable support and assistance greatly contributed to the success of this research.

Conflict of Interest

The authors declare that there are no competing interests related to this work.

Funding

This research was supported by RIIM Kompetisi funding from the Indonesia Endowment Fund for Education Agency, Ministry of Finance of the Republic of Indonesia and National Research and Innovation Agency of Indonesia according to the contract number: NO 82/II.7/HK/2022.

Author contributions

M.M. (Formal analysis, Methodology, Data curation, Writing-review & editing), D.H. (Conceptualization, Data curation, Funding acquisition & review), E.M. (Data curation, Formal analysis, Methodology), A.N.F (Methodology, Visualization & Data curation).

Ahmad M, Hirz M, Pichler H, et al. Protein expression in Pichia pastoris: recent achievements and perspectives for heterologous protein production. Appl Microbiol Biotechnol. 2014 Jun;98(12):5301–17. Doi:10.1007/s00253-014-5732-5
Barlowe CK, Miller EA. Secretory protein biogenesis and traffic in the early secretory pathway. Genetics. 2013 Feb;193(2):383–410. Doi: 10.1534/genetics.112.142810
Brandis G, Hughes D. The selective advantage of synonymous codon usage bias in Salmonella. PLoS Genet. 2016 Mar;12(3):e1005926. Doi: 10.1371/journal.pgen.1005926
Cereghino JL, Cregg JM. Heterologous protein expression in the methylotrophic yeast Pichia pastoris. FEMS Microbiol Rev. 2000;24(1):45–66. https://doi.org/10.1111/j.1574-6976.2000.tb00532.x
Cregg JM, Tolstorukov I, Kusari A, et al. Expression in the yeast Pichia pastoris. Methods Enzymol. 2009;463:169–89. Doi: 10.1016/S0076-6879(09)63013-5
Daly R, Hearn MTW. Expression of heterologous proteins in Pichia pastoris: a useful experimental tool in protein engineering and production. J Mol Recognit: JMR. 2005;18(2):119–38. Doi: 10.1002/jmr.687.
Delic M, Valli M, Graf AB, et al. The secretory pathway: exploring yeast diversity. FEMS Microbiol Rev. 2013 Nov 1;37(6):872–914. https://doi.org/10.1111/1574-6976.12020
Feizi L, Saeedinia AR, Zeinoddini M, et al. Overexpression and purification of the synthetic human proinsulin to efficient produce glargine insulin in E. coli. Biomacromolecular J. 2020;6(1):17–24. https://www.bmmj.org/article_243530.html
Gustafsson C, Govindarajan S, Minshull J. Codon bias and heterologous protein expression. Trends Biotechnol. 2004 Jul;22(7):346–53. Doi: 10.1016/j.tibtech.2004.04.006.
Gustafsson C, Minshull J, Govindarajan S, et al. Engineering genes for predictable protein expression. Protein Expr Purif. 2012 May;83(1):37–46. Doi: 10.1016/j.pep.2012.02.013.
Hwang H, Kim K, Lee S, et al. Recombinant glargine insulin production process using Escherichia coli. J Microbiol Biotechnol. 2016;26(10):1781–9. Doi: 10.4014/jmb.1602.02053.
Kaki SB, Chintagunta AD, Prasad AN, et al. Production and purification of recombinant glargine insulin from Escherichia coli BL-21 strain. Emergent Mater. 2022;5:335–46. https://doi.org/10.1007/s42247-021-00313-3
Karbalaei M, Rezaee SA, Farsiani H. Pichia pastoris: A highly successful expression system for optimal synthesis of heterologous proteins. J Cell Physiol. 2020 Sep;235(9):5867–81. Doi: 10.1002/jcp.29583.
Li P, Anumanthan A, Gao X-G, et al. Expression of recombinant proteins in Pichia pastoris. Appl Biochem Biotechnol. 2007 Aug;142(2):105–24. Doi: 10.1007/s12010-007-0003-x.
Macauley-Patrick S, Fazenda ML, McNeil B, et al. Heterologous protein production using the Pichia pastoris expression system. Yeast. 2005;22(4):249–70. Doi: 10.1002/yea.1208.
Martinet W, Maras M, Saelens X, et al. Modification of the protein glycosylation pathway in the methylotrophic yeast Pichia pastoris. Biotechnol Lett. 1998;20(12):1171–7. https://doi.org/10.1023/A:1005340806821
Mauro VP, Chappell SA. A critical analysis of codon optimization in human therapeutics. Trends Mol Med. 2014 Nov;20(11):604–13. Doi: 10.1016/j.molmed.2014.09.003.
McKeage K, Goa KL. Insulin Glargine. Drugs. 2012;61(11):1599–624. https://doi.org/10.2165/00003495-200161110-00007
Menzella HG. Comparison of two codon optimization strategies to enhance recombinant protein production in Escherichia coli. Microb Cell Fact. 2011;10(1):15. https://doi.org/10.1186/1475-2859-10-15
Novoa EM, Ribas de Pouplana L. Speeding with control: codon usage, tRNAs, and ribosomes. Trends Genet 2012;28(11):574–81. Doi: 10.1016/j.tig.2012.07.006.
Nurdiani D, Hariyatun H, Utami N, et al. Enhancement in human insulin precursor secretion by Pichia pastoris through modification of expression conditions. HAYATI J Biosciences. 2022;29(1):22–30. https://doi.org/10.4308/hjb.29.1.22-30
Nurdiani D, Putro EW, Septisetyani EP, et al. Characterization of functional human insulin produced using the Pichia pastoris expression system. J Appl Pharmaceutical Science. 2024;0(00):001–1. Doi: 10.7324/JAPS.2024.180473
Owens DR. New horizons-alternative routes for insulin therapy. Nat Rev Drug Discov. 2002 Jul;1(7):529–40. Doi: 10.1038/nrd836.
Pronobis MI, Deuitch N, Peifer M. The Miraprep: A protocol that uses a Miniprep Kit and provides Maxiprep yields. PlosOne. 2016;11(8):e0160509. Doi: 10.1371/journal.pone.0160509
Puxbaum V, Mattanovich D, Gasser B. Quo vadis? The challenges of recombinant protein folding and secretion in Pichia pastoris. Appl Microbiol Biotechnol. 2015;99(7):2925–38. Doi: 10.1007/s00253-015-6470-z
Quax TEF, Claassens NJ, Söll D, et al. Codon bias as a means to Fine-Tune gene expression. Mol Cell. 2015 Jul;59(2):149–61. Doi: 10.1016/j.molcel.2015.05.035
Schägger H. Tricine–sds-page. Nat Protoc. 2006;1(1):16–22. Doi: doi: 10.1038/nprot.2006.4.
Sinclair G, Choy FYM. Synonymous codon usage bias and the expression of human glucocerebrosidase in the methylotrophic yeast, Pichia pastoris. Protein Expr Purif. 2002 Oct;26(1):96–105. doi: 10.1016/s1046-5928(02)00526-0.
Thevis M, Thomas A, Delahaut P, et al. Qualitative determination of synthetic insulin analogues in human plasma by means of LC-MS / MS. 2005;245–54.
Wang F, Carabino JM, Vergara CM. Insulin glargine: A systematic review of a long-acting insulin analogue. Clin Ther. 2003;25(6):1541–77. Doi: 10.1016/s0149-2918(03)80156-x.
Wong MY, DiChiara AS, Suen PH, et al. Adapting secretory proteostasis and function through the unfolded protein response. Curr Top Microbiol Immunol. 2018;414:1–25. Doi: 10.1007/82_2017_56.
Yadav S, Parakh A. Insulin therapy. Indian pediatr. 2006 Oct;43(10):863–72.
Yu P, Yan Y, Gu Q, et al. Codon optimisation improves the expression of Trichoderma viride sp. endochitinase in Pichia pastoris. Sci Rep. 2013;3(1):3043. Doi: 10.1038/srep03043.

The authors declare no competing interests.

Download PDF

Version 1

posted

You are reading this latest preprint version

Insulin glargine production: Codon engineering in Pichia pastoris X-33 for enhanced therapeutic yield

Status:

Version 1

Abstract

Aims

Materials and methods

Results

Conclusion

Figures

1. Introduction

2. Materials and methods

2.1. Codon optimization of Insulin glargine Precursor gene (IP glargine).

2.2. Transformation pPICZalpha-IP-glargine in E. coli Top10.

2.3. Isolation of Plasmid

2.4. Linearization with SacI enzyme.

2.5. Transformation pPICZalpha-G in Pichia pastoris X33

2.6. DNA Amplification of the IP-glargine genes in the Pichia pastoris genome

2.7. Culture condition of IP-glargine production

2.8. Protein analysis

2.9. Cation Exchange Chromatography

2.10. Reversed-Phase High-Performance Liquid Chromatography (RP-HPLC) Analysis

3. Results

3.1. Integrated pPICZa-G in Escherichia coli

3.2. Integrated pPICZa-G into Pichia pastoris X33 genome.

3.3. Production of glargine in ½ BSM culture

4. Discussion

Declarations

References

Additional Declarations

Status:

Version 1