Alk1/Endoglin signaling restricts vein cell size increases in response to hemodynamic cues and limits ribosomal biogenesis

doi:10.21203/rs.3.rs-4421247/v1

Download PDF

Research Article

Alk1/Endoglin signaling restricts vein cell size increases in response to hemodynamic cues and limits ribosomal biogenesis

https://doi.org/10.21203/rs.3.rs-4421247/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 10 Dec, 2024

Read the published version in Angiogenesis →

You are reading this latest preprint version

Hemodynamic cues are thought to control blood vessel hierarchy through a shear stress set point, where flow increases lead to blood vessel diameter expansion, while decreases in blood flow cause blood vessel narrowing. Aberrations in blood vessel diameter control can cause congenital arteriovenous malformations (AVMs). We show in zebrafish embryos that while arteries behave according to the shear stress set point model, veins do not. This behavior is dependent on distinct arterial and venous endothelial cell (EC) shapes and sizes. We show that arterial ECs enlarge more strongly when experiencing higher flow, as compared to vein cells. Through the generation of chimeric embryos, we discover that this behavior of vein cells depends on the Bone Morphogenetic Protein (BMP) pathway components Endoglin and Alk1. Endoglin (eng) or alk1 (acvrl1) mutant vein cells enlarge when in normal hemodynamic environments, while we do not observe a phenotype in either acvrl1 or eng mutant ECs in arteries. We further show that an increase in vein diameters initiates AVMs in eng mutants, secondarily transmitting higher flow to arteries. These enlarge in response to higher flow through increasing arterial EC sizes, fueling the AVM. Finally, single cell sequencing results and immunofluorescence analysis indicate that increases in vein EC sizes in eng mutants are likely caused by increases in ribosome biogenesis and downregulation of the translational inhibitor dap1b. This study thus reveals a mechanism through which BMP signaling limits vein EC size increases in response to flow and provides a framework for our understanding of how a small number of mutant vein cells via flow-mediated secondary effects on wildtype arterial ECs can precipitate larger AVMs in disease conditions, such as hereditary hemorrhagic telangiectasia (HHT).

Endoglin

Alk1

Hereditary Hemorrhagic Telangiectasia

Shear Stress Set Point

Endothelial Cell Size

Artery

Vein

Ribosomal biogenesis

Zebrafish

Biological tubes are the fundamental structural units of many organs, including the vascular system ¹. A hierarchical organization of correctly sized tubes ensures an appropriate distribution of liquids or air to all parts of the body. Aberrations in the diameter of these vessels can disrupt this hierarchy and cause congenital vascular disorders, including Hereditary Hemorrhagic Telangiectasia (HHT), Cerebral Cavernous Malformations (CCM) and Venous and Lymphatic Malformations ². Understanding the mechanisms regulating blood vessel diameters in vivo will therefore not only shed light on the processes shaping biological tubes, but also help in developing new therapies for vascular disorders.

Feedback mechanisms exist between the forces (fluid shear stress or FSS among them) that the flowing blood exerts on a given blood vessel and its diameter ^3,4. The shear stress set point theory proposes that FSS below or above a specific threshold initiates vessel remodelling: constricting for low FSS and dilating for high FSS, to return to the original shear stress level and uphold homeostasis ^5,6. However, the existence of a shear stress set point for both arteries and veins would mean that the unchecked increase in blood flow during embryonic development would result in continual increases in vessel diameters of the shortest connection between an artery and a vein, leading to the formation of an arteriovenous shunt ⁷. Therefore, mechanisms must exist to counteract the effects of shear stress set point-driven blood vessel dilations. Mural cells are known to regulate blood vessel dilation and constriction in response to shear stress ⁸. However, mural cells do not mature until later in development, and in the zebrafish axial vasculature this occurs at around 72 hpf ⁹. Hence, during earlier developmental stages, blood vessel diameter control relies on EC specific mechanisms. While it is well established that gene expression differences exist between ECs of distinct blood vessel types, few studies have analysed how these differences might affect EC morphologies ^10,11. It is also not clear, whether differences in blood vessel diameters are due to differences in EC numbers or shapes ^12,13.

The analysis of mutants that develop arteriovenous shunts has provided inroads into these mechanisms. A loss of function of BMP pathway components, such as Endoglin, Alk1 or Smad4, frequently results in arteriovenous malformations (AVMs), both in human patients suffering from HHT and in zebrafish and mouse models of the disease ^14–18. These studies suggested that either increases in endothelial cell (EC) numbers (through proliferation or migration) or changes in EC sizes are the main driver to increase vessel diameters. A recent study investigating SMAD4 loss of function in ECs further showed that mutant cells had increased sensitivity to flow, ultimately leading to loss of arterial identity because of excessive EC proliferation ¹⁹. Blocking proliferation can rescue AVM formation in mice lacking Alk1 signaling ²⁰. Loss of arterial marker gene expression, such as Efnb2 and Jag1 in addition to tracking of AVM onset in mouse retinae also suggested that arterioles are the first vessel segments displaying a phenotype in acvrl1 (alk1) and eng mutant mice ^21–23 or alk1 mutant zebrafish ¹⁷. Other studies, however, showed that both Alk1 and Endoglin were required in venous and capillary ECs while being dispensable in arteries ^24,25. Early observations of vascular lesions in HHT patients reported that postcapillary venule sizes were the first to increase ²⁶. Together, these results suggest that it has either been difficult to distinguish primary from secondary effects caused by loss of Alk1/Endoglin signaling or that distinct mechanisms trigger arteriovenous malformations depending on the tissue and/or vascular bed analyzed.

Here, we report that the dorsal aorta and the posterior cardinal vein of zebrafish embryos consist of ECs of different shapes and sizes and that flow increases result in an increase in arterial EC sizes. Alk1/Endoglin signaling is required within ECs of the posterior cardinal vein to restrict their size increase, while being dispensable within arterial ECs. Our results suggest that vein ECs in eng mutants increase in size because of increased ribosomal biogenesis. Of importance, we previously showed that ECs in the dorsal aorta enlarged in eng mutant zebrafish embryos ¹⁸. Our current study indicates that this expansion is likely a secondary consequence due to increases in blood flow. Together, these results link the development of appropriate vascular patterns in response to changing hemodynamic cues with distinct morphological responses of venous and arterial ECs to these cues. Additionally, they emphasize the significance of Alk1/Endoglin signalling in a cell-type-specific manner throughout this process.

The dorsal aorta and posterior cardinal vein show differential growth during development and are made up of ECs with distinct dimensions

To investigate the mechanisms regulating blood vessel sizes during embryonic development, we performed timelapse imaging of the major artery (dorsal aorta, DA) and major vein (posterior cardinal vein, PCV) in the zebrafish embryo starting at 24 hours post fertilization (hpf ; when the vessels have just formed and lumenized) until 72 hpf (Fig. 1a). We further distinguished between anterior and posterior DA and PCV regions, since they experience differences in blood flow magnitude ²⁷. To determine whether blood vessel diameters depend on differences in cell numbers or cell shapes, we measured DA and PCV diameters and determined EC shapes and numbers. We observed that in the trunk region, the vein started out with a significantly larger diameter than the artery at 24 hpf (Fig. 1b, c). Arterial diameters increased from 24–48 hpf, correlating with increases in blood flow magnitude ²⁸. By contrast, the vein showed minimal fluctuations in diameter during this time interval. Using Tg(fli1a:nEGFP)^y7 embryos to label EC nuclei, we discovered that the vein had significantly higher EC numbers compared to the artery (Suppl. Figure 1a), while venous EC proliferation rate was not significantly different from that of the artery (Suppl. Figure 1b, i, j). Both arterial and venous EC numbers decreased over time (Suppl. Figure 1a), correlating with migration of ECs out of the vessels ²⁹. Thus, increases in arterial diameters between 24–48 hpf cannot be explained by increases in EC numbers. However, changes in EC sizes for both the artery and vein between 24 and 48 hpf correlated with diameter changes (Fig. 1c). No significant changes in EC size were noticed between 48 and 72 hpf. Nevertheless, arterial and venous ECs aligned to the vessel axis (Suppl. Figure 1c), correlating with a decrease in vessel diameter (Fig. 1c). In conclusion, our observations indicate that the trunk artery grows in diameter through an increase in EC sizes, while the trunk vein undergoes marginal changes over time.

We made similar observations concerning the tail vessels, despite the tail vein undergoing extensive angiogenic remodelling between 24–48 hpf to give rise to two distinct but connected structures – the caudal plexus and the caudal vein (Fig. 1b, see tail images) ³⁰. This splitting of the vessel led to a significant decrease in tail vein diameter between 24 and 36 hpf (Fig. 1c). Of note, the differences between tail artery and vein diameters and EC sizes were less pronounced when compared to trunk vessels (Fig. 1b, c; Suppl. Figure 1e-h). To obtain a more comprehensive view of differences in cell shapes between arteries and veins and how they change over time, we displayed all EC shape parameters (area, perimeter, elongation, and alignment) in Uniform Manifold Approximation and Projection (UMAP) plots (Fig. 1d-g). This analysis revealed that vein cells differed less over time when compared to arterial ECs, especially in the trunk region (Fig. 1d, e). Together, these findings show a remarkable diversity in EC shapes not only between arterial and venous blood vessels, but also dependent on their anterior-posterior location along the length of a given blood vessel. They further indicate that the profound changes in blood flow magnitude occurring in zebrafish embryos between 24 and 72 hpf, both in the vein and artery, differentially affect the morphology of arterial and venous ECs. In the artery, cell sizes and vessel diameters correlate, as larger arterial segments are made up of bigger ECs. By contrast, in the vein there is a reverse relationship between vessel diameter and EC sizes. Here, the vein segments with larger diameters contain smaller ECs (Fig. 1h).

Changes in blood flow influence arterial diameters and EC sizes while veins respond less

To directly test the hypothesis that blood vessels change their diameters according to the shear stress set point model, we reduced blood flow in zebrafish embryos through tricaine treatment for two hours at 24, 36, 48 and 72 hpf and measured blood vessel diameters and EC shapes (Fig. 2a). We observed that in tricaine-treated embryos, trunk arterial ECs showed a significant reduction in their size in correlation with a decrease in vessel diameter at 26, 38 and 50 hpf (Fig. 2a, b, d-f). By contrast, venous ECs were unaffected by a reduction in flow, with fairly small changes in venous diameter (Fig. 2b, d, e, g). Thus, in the trunk, blood flow reduction results in the predicted inward remodeling of arteries, a behavior that is however not observed in veins.

The tail artery of tricaine-treated embryos showed similar trends in EC size and vessel diameter changes in response to flow reduction (Fig. 2c, h-j). In the case of the tail vein, blood flow reduction resulted in two distinct outcomes in respect to vessel diameter and EC shapes: first, tail vein diameters of tricaine-treated embryos were larger than those of controls at 26 and 38 hpf (Fig. 2h). This was due to inhibition of blood flow dependent angiogenic remodeling ^31,32. However, tail vein EC sizes changed like arterial EC sizes when treated between 48 and 50 hpf in such that they became smaller (Fig. 2i, k). Together, our results indicate that arterial diameters respond to changes in blood flow in both trunk and tail regions in a manner that is consistent with the presence of a shear stress set point. We further show that this response is driven through changes in EC shapes, establishing hemodynamic cues as an important determinant of arterial EC shapes. The vein’s response is context-dependent; the trunk vein is not affected by either increases or decreases in flow and thus does not seem to have a shear stress set point, while tail vein ECs behave like arterial ECs at later developmental time points.

Global loss of endoglin increases EC size in both the artery and vein.

The finding that veins respond less to changes in blood flow suggests that there are mechanisms operating in the vein that spatially restrict their increase in area in response to flow. We previously showed that the BMP signaling pathway co-receptor Endoglin regulates trunk artery diameters during zebrafish development by controlling EC shape and size ¹⁸. As Endoglin is principally expressed in the vein (Suppl. Figure 2a), we extended our analysis to venous regions of the mutant vasculature (Fig. 3a, b). We found no significant differences in the number, elongation or alignment of eng mutant ECs in either the trunk (Suppl. Figure 3a-c) or the tail vessels (Suppl. Figure 3d-f). As shown earlier ¹⁸, we observed an increase in EC sizes in trunk arterial ECs, while trunk vein cells did not change in size (Fig. 3c). In the tail, both artery and vein cells increased in area (Fig. 3e). These changes in EC sizes correlated with an increase in the diameters of the respective vessels (Fig. 3d, f). Of note, while we observed a similar percentage of area increase (17%) in both trunk and tail arterial ECs in eng mutants compared to siblings, tail vein ECs were 50% larger in mutants compared to siblings (Fig. 3e). This difference is also reflected when using UMAPs to plot EC shape parameters (Fig. 3g, h). Collectively, these observations indicate that although global loss of eng affects both arterial and venous diameters mainly through an increase in EC areas, the most prominent effect on EC sizes and shapes can be observed in the tail vein (Suppl. Figure 3g, h).

Endoglin and Alk1 function cell autonomously to restrict venous EC size

We previously showed that arterial blood flow is higher in eng mutants ¹⁸. We now find that in wildtype embryos, arterial ECs increase in size in response to increases in blood flow. This led us to hypothesize that the increase in arterial EC sizes in eng mutants might be a secondary effect of increased blood flow, driven by a primary cellular defect in eng mutant vein ECs. To address this question, we generated chimeric embryos, in which only a few ECs were mutant in an otherwise wildtype vasculature. Briefly, we transplanted cells from eng mutant or wildtype donor embryos into wildtype recipients and determined the morphology of donor ECs in chimeric embryos at 72 hpf (Fig. 4a). We observed that transplanted mutant arterial ECs were not significantly different in size compared to wildtype arterial ECs. By contrast, transplanted mutant venous ECs were significantly larger than their wildtype counterparts in both the trunk and the tail (Fig. 4b-g). No difference was observed in elongation and alignment between mutant and wildtype transplanted ECs (Suppl. Figure 4a, b). This indicates that expression of eng in veins is cell-autonomously required to restrict venous EC sizes and that the arterial EC size increase in eng mutants is most likely a secondary response caused by increased flow.

Next, we interrogated whether alk1, a gene mainly expressed in arterial ECs (Suppl. Figure 2b), was similarly required to restrict vein EC sizes. The presence of a large shunt in the head, diverting flow from the trunk, precludes an analysis of DA and PCV diameters and EC shapes in global alk1 mutants ¹⁷. Transplanted alk1 mutant ECs behaved similarly to eng mutant transplanted ECs (Fig. 4h-m). Mutant arterial ECs were not significantly different in size compared to wildtype cells, while mutant venous ECs were nearly 50% larger in both the trunk and the tail (Fig. 4h-m). Elongation and alignment were comparable between mutant and wildtype ECs (Suppl. Figure 5a, b). Together, these findings indicate that the primary cellular defect in both eng and alk1 mutants is in venous ECs, causing a flow-dependent enlargement of these cells.

Initiation of vessel dilation in endoglin mutants occurs in the tail vein

We reasoned that if the primary defect in eng mutants is indeed in vein ECs, we should observe increases in vein diameters prior to increases in artery diameters. To address this question, we performed a time resolved analysis of tail arterial and venous diameters in wildtype and eng mutant embryos from 50–72 hpf. To accommodate for differences in vessel diameter between anterior and posterior tail regions, we divided the tail into an anterior and a posterior segment (Fig. 5a). We observed that while wildtype vessels decreased their diameters during this time interval, eng mutant arteries and veins dilated (Movies 1–4). We noticed a larger increase in eng mutant venous compared to arterial diameters in both tail segments. We also observed a difference in the timepoint when mutant diameters diverged from wildtype for the artery versus the vein. The first increase in eng mutant vessel diameter was initiated in the posterior tail vein at around 58 hpf, followed by increases in the posterior tail artery diameter at around 60 hpf (Fig. 5b, c; Suppl. Figure 5). At around 63 hpf, the mutant anterior tail artery and vein diverged from wildtype (Fig. 6d, e; Suppl. Figure 5). These data support our hypothesis that in eng mutants vein ECs cell autonomously enlarge in response to flow, decreasing flow resistance in the tail vein and thereby sending more blood to arterial vessels, which secondarily enlarge in response to increased flow.

Single cell sequencing reveals changes in ribosome biogenesis in eng mutant vein ECs

To interrogate the possible reason for the observed increase in vein EC sizes, we performed single cell sequencing of FACS sorted EGFP expressing trunk cells from Tg(kdrl:EGFP)^s843 wildtype and eng mutant embryos at 72 hpf (Suppl. Figure 6). We obtained mRNA from about 40,000 cells in replicate libraries and identified 26 cell clusters. Our analysis revealed that the majority of EGFP expressing cells did not express kdrl (Suppl. Figure 6c), suggesting that they potentially exhibited ectopic low EGFP expression, as we chose to include most EGFP expressing cells due to variability of EGFP expression within EC cells. Alternatively, they might show persistent EGFP expression from a kdrl expressing progenitor cell population. We subsequently focused on the 2794 kdrl expressing cells that also expressed the endothelial marker gene cdh5 ³³ (Suppl. Figure 6b-d). Subclustering and analysis of marker gene expression yielded 11 separate cell populations that we could map to distinct anatomical locations within the 72 hpf zebrafish embryo (Fig. 6a). Analysis of known arterial and venous EC genes identified 3 distinct arterial and 3 venous clusters (Fig. 6b, c, summarized in Fig. 6d, e). Further analysis using fluorescent in situ mRNA hybridization allowed us to validate tail and trunk PCV (Fig. 6f, g) in addition to cells in the dorsal longitudinal anastomotic vessel (DLAV), ISVs and newly emerging caudal fin vessels (Fig. 6h). Notably, newly emerging subintestinal vessels formed a separate cluster that was marked by nkx2.3 expression (Fig. 6i). Together, these data provide a comprehensive single cell map of ECs in the trunks of 72 hpf old zebrafish embryos.

We then compared cell populations between wildtype and eng mutant animals. All cell clusters could be readily identified in both genotypes (Suppl. Figure 6e). The most strongly downregulated gene in eng mutants was eng itself (Fig. 7a, Suppl. Figure 6f), confirming our previous gene expression results using standard mRNA in situ hybridization ¹⁸. Our data also revealed upregulation of angpt2a expression, as previously reported in smad4 knockout mice ³⁴. In addition, we most prominently found changes in expression in genes regulating translation. The recently identified negative regulator of translation dap1b ³⁵ was downregulated in vein ECs, in addition to a range of ribosomal proteins that were upregulated in vein ECs (Fig. 7a, c, example rps13 provided here). Gene ontology and pathway analysis revealed an activation of ribosome biogenesis and translation in mutant tail PCV cells, while processes, such as lipid metabolism, were suppressed (Fig. 7b, d, e). To directly visualize increases in ribosome biogenesis, we performed immunofluorescence using an antibody detecting the nucleolar protein fibrillarin ³⁶. We detected an increase in nucleoli numbers, indicative of enhanced ribosomal biogenesis in eng mutants in venous ECs (Fig. 7f-h). Thus, enlarged vein ECs in eng mutants display increased ribosomal biogenesis and protein translation. Together, our results reveal the importance of Endoglin signaling to restrain increases in vein EC sizes in response to flow (Suppl. Figure 8).

Despite the importance of maintaining vascular hierarchy, we still do not understand the cellular and molecular mechanisms that spatiotemporally establish blood vessel diameters. Our current study shows profound differences in size and shape of arterial and venous ECs and how these differences affect blood vessel diameters. These findings add to a growing body of whole organism single cell morphology and gene expression data, as performed for the nereid Platynereis dumerilii ³⁷. In the future, this work will allow us to understand how cell morphologies and their underlying gene expression patterns inform organ development and function. Our cell morphology data is limited, as it only contains 2D cell shape information. However, it benefits from being acquired in living animals, avoiding fixation artifacts that can compromise the topologies of tubular organs ^38,39.

Our analysis revealed a positive correlation of EC sizes with vessel diameters for arteries, while we discovered an inverse correlation between cell sizes and vessel diameters for veins. We also uncovered that vein ECs are smaller when compared to arterial ECs and that veins contain more cells in comparison to arteries. At present, we can only speculate as to why this might be the case. Arterial ECs can differentiate through sprouting angiogenesis from venous endothelium, a process that requires downregulation of vein EC proliferation ^40–45. In other settings, slowly cycling precursor cells are also smaller than their differentiated progeny ⁴⁶. Thus, vein ECs might be considered the vascular “stem cell pool” from which other vascular lineages differentiate. This view would be consistent with reports showing that the majority of lymphatic ECs are also vein derived ⁴⁷.

Recent results show that in larger cells cell cycle inhibitors are more dilute when compared to cell cycle activators ^48,49. This could indicate that in Alk1/Endoglin mutants, aberrant increases in cell size subsequently lead to an increase in proliferation and thereby secondarily to an increase in cell numbers in affected vessels, causing even greater increases in blood vessel diameters. Indeed, similar to findings in mammalian HHT models ^50,51, we have observed an increase in vein EC numbers within the fin vasculature of adult eng mutants ¹⁸. Jin et al. showed that in AVMs, both eng mutant and wildtype cells proliferated more, suggesting that increases in EC proliferation might be a secondary effect due to aberrant EC sizes. Together, these findings illustrate the significance of understanding and separating primary from secondary effects, which are likely occurring due to changes in hemodynamics that result from loss of Alk1/Endoglin function.

We find that increases in blood flow led to an increase in arterial EC sizes together with an increase in artery diameter. Thus, arterial vessels behave according to the shear stress set point theory with diameter changes driven through changes in EC shapes at developmental stages prior to mural cell investment. By contrast, vein ECs react less to increases in flow and maintain their sizes, preventing the uncontrolled diameter increase of a short connection between an artery and a vein, as previously proposed ⁷. This suggests a mechanism in venous ECs that tunes activation of a signalling pathway according to the amount of shear stress a given cell encounters. We propose that this pathway acts through Alk1 and Endoglin. Previous work showed that Endoglin can potentiate Alk1 signalling in response to shear stress ⁵. SMAD1 nuclear translocation also increased with increases in shear stress up to a set-point value, while decreasing again at higher shear rates ⁵². These studies were performed in HUVECs (Human Umbilical Vein Endothelial Cells) and it would be of interest to determine whether increases in shear stress during embryonic development would lead to similar increases in SMAD1 nuclear translocation in vein ECs and presumably BMP signalling pathway activation.

The finding that arterial ECs lacking Alk1 or Endoglin do not show a phenotype when in a normal hemodynamic environment is surprising. However, previous studies reported that small telangiectasias in HHT patients preferentially affected postcapillary venules ²⁶. Similarly, inducing angiogenesis in Eng mutant mice resulted in venomegaly ⁵¹. Specifically deleting Eng or Alk1 in capillary and venous ECs resulted in similar AVM frequency in the mouse retina when compared to pan-endothelial deletion of either gene ^24,25 or when examining shunts in a model of oxygen induced retinopathy ⁵³. These results suggest that the primary EC cell type affected by loss of Alk1/Endoglin signalling are indeed venous ECs. A notable exception is the brain, where arterial ECs forming the Circle of Willis in zebrafish are most prominently affected ¹⁷. Thus, whether an EC population is affected in mutant animals might also depend on additional parameters, such as angiogenic status.

Earlier studies have linked AVM development to an upregulation of the Phosphatidylinositol 3-kinase (PI3K) pathway ^21,54,55. Of note, overactivation of PI3K signalling only leads to vascular malformations in veins and capillaries, but not in arteries ^56–58. Thus, differentiated arterial ECs appear to be refractory to both loss of Alk1/Endoglin signalling and enhanced PI3K signalling. In addition to causing vascular malformations, overactivation of PI3 kinase signalling is a hallmark of cancer ⁵⁹. Thus, identifying the mechanism through which arterial cells fail to respond to increases in PI3K signalling might also help in developing cancer treatments.

How PI3K signalling might affect EC sizes is currently unknown. Previous studies showed that cell autonomous loss of PI3K signalling led to an increase in EC areas in the mouse retina ⁶⁰. However, in Alk1/Endoglin mutants, increases in EC sizes correlate with an increase in PI3K signalling and blocking PI3K signalling can rescue vascular phenotypes in Alk1/Endoglin mutants ^54,55,61. It is well established that mTOR downstream of PI3K signalling promotes cell growth through controlling translation and ribosomal biogenesis ⁶². Blocking mTOR signalling can reverse shunts in mice lacking BMP9/10 and in Endoglin mutant zebrafish ^61,63, like vascular malformations in mice with overactivated PI3 kinase signalling ^56,57,64 or in a model of oxygen induced retinopathy ⁵³. Our single cell sequencing data now provide evidence that an upregulation of ribosomal biogenesis, likely because of over-activated mTOR signalling, contributes to increases in EC sizes in eng mutants. This is also evidenced through our finding that in eng mutant vein ECs nucleoli numbers are increased. Thus, cellular growth needs to be tightly controlled within ECs to prevent vascular malformations. Of note, we also detected downregulation of the translational inhibitor dap1b. Dap1b was recently identified to repress translation in dormant zebrafish eggs ³⁵. Therefore, loss of Alk1/Endoglin signalling increases both the number of ribosomes and their translational activity.

Our findings in chimeric animals help in understanding the puzzling finding that in many vascular lesions in HHT patients only a small number of ECs are mutant ^65–67. Our results now suggest that only a few vein cells need to be mutant and that arterial ECs subsequently respond to higher flow with increases in their areas, as they would in wildtype animals. Thus, a normal physiological response that is necessary to maintain the shear stress set point in arteries results in a maladaptation of these vessels in a disease setting. This response would then lead to the arterial vessel, even though it consists of genotypically wildtype cells, to enlarge and become part of an arterio-venous malformation. Further insights into these feedback loops might therefore aid our understanding of the heterogeneity of phenotypes observed in HHT patients and pave the way for better treatment options.

Zebrafish husbandry and strains

All research protocols involving zebrafish were approved by the University of Pennsylvania Institutional Animal Care and Use Committee (number 806819). Our investigations have (i) local approval and (ii) all procedures conform to the guidelines from the NIH Guide for the Care and Use of Laboratory Animals. Euthanasia was performed using rapid chilling. Zebrafish veterinary care was performed under the supervision of the University Laboratory Animal Resources at the University of Pennsylvania. Zebrafish embryos were maintained in 1X E3 medium under recommended animal husbandry conditions ⁶⁸ and in accordance with institutional and national regulatory standards. Transgenic lines and mutants used were Tg(fli1a:lifeactGFP)^mu²⁴⁰, Tg(fli1a:nEGFP)^y⁷, Tg(kdrl:EGFP)^s843, Tg(kdrl:Hsa.HRAS-mCherry)^s916, eng^mu130, and alk1^y6. References for all zebrafish lines can be obtained on http://zfin.org.

Live imaging and confocal microscopy

24-72 hpf embryos were mounted on a glass-bottom dish using 1% low-melting-point agarose containing 168 mg/l tricaine and 0.003% phenylthiourea (to prevent pigment formation). For time-lapse imaging, a heated microscope stage was used to maintain a constant temperature of 28.5°C. Confocal z-stacks were acquired on an SP8-inverted (Leica Microsystems) or LSM880 (Zeiss) scanning confocal microscope.

Tricaine treatments

Embryos were dechorionated and treated with 0.5 mg/ml tricaine (Millipore Sigma) in 1X E3 containing 0.003% phenylthiourea for 2 h intervals at 24, 36, 48 and 72 hpf, and imaged immediately after.

Image processing

Imaris software (Oxford Instruments) was used for image analysis, including maximum intensity projections, mp4 movies, cell shape tracings, and measurement of vessel diameters, cell numbers and cell proliferation. Adobe Illustrator software was used to assemble figures and create schematics.

Vessel diameter, cell number and cell shape analysis

To calculate vessel diameters, measurements were taken at the midway point between ISVs no. 7-15 for trunk and ISVs no. 16-24 for tail. The mean was used as an average diameter per embryo per trunk or tail region. Nuclei counts were obtained for 430µm length of each vessel between ISVs no. 7-15 for trunk and ISVs no. 16-24 for tail.

Cell shape analysis was performed as described previously ¹⁸. Briefly, Tg(fli1a:lifeactGFP; fli1a:nEGFP)^mu^240,y7 double transgenic embryos were imaged with a 40X air or 63X water objective. Imaris software was used to manually trace cell outlines with an average of 100 measurement points per cell. Using a custom MATLAB script, these points were then unrolled onto a two-dimensional surface, and an ellipse or a hyperbola was fitted through the measurement points. Cell area, elongation and alignment were then calculated from the two-dimensional projection.

UMAP plots on cell shape parameters

Four cell shape parameters (area, angle, elongation, and perimeter) of each unrolled EC were quantified and exported from a Matlab script into a csv file. A Python script was designed to organize these parameters and map them into UMAPs. The script organized the four parameters together with their corresponding cells’ identities such as cell name, cell location, vessel type, and age, etc. into a DataFrame. Then normalization was applied to the four parameters’ dimensions, followed by UMAP projection. The first and second dimensions of the projected UMAP space were shown with scatter plots. To show the clustering and distance features of each cell group, an ellipse was fitted to outline the main part of the scattered points of each cell type. Finally, cell points and the bounding ellipses from the selected cell types were shown on the UMAP plots to compare their similarities and distances.

Proliferation rate

Time-lapse movies were analyzed for cells that displayed nuclear dissociation and subsequent cell division. Proliferation events were counted for each vessel between 24-36, 36-48 and 48-72 hpf and normalized to the total cell number (per 430 µm vessel length) to obtain rates of proliferation.

Blastomere transplantations

Cell transplantations were performed as described previously ⁶⁹. Wildtype, eng^mu130 or alk1^y6mutant embryos with Tg(fli1a:lifeactGFP; fli1a:nEGFP)^mu^240,y7 were used as donors, while recipients were wildtype Tg(kdrl:Hsa.HRAS-mCherry; fli1a:nEGFP)^s916,y7 embryos.

EC isolation for single cell RNA sequencing

Embryos from an incross of wildtype or eng^mu130Tg(kdrl:EGFP)^s843 fish were incubated in culture dishes until 72 hpf. At 72 hpf, embryos were first anesthetized by 1X tricaine, then trunk and tail parts of the body were cut out by two syringes with needles (0.4 mm x 13 mm) which were then transferred into 1X HBSS (diluted from 10X HBSS, Gibco, #14185-052). Yolk extensions were removed by pipetting in calcium-free Ringer’s solution, spinning down, and washing twice with 1X HBSS. Deyolked embryos were then transferred into 0.04% BSA pre-coated tubes containing collagenase and TrypLE (add 80 µL 50 mg/ml collagenase IV (Gibco, #17104-019) into 1 ml preheated TrypLE (Gibco, #12604-021)). Embryos in collagenase were then dissociated in 28°C for around 50 minutes, with pipetting applied every 10 minutes. The reaction was stopped by the addition of 100 µl FBS. Cells were collected by centrifugation at 350×g (rcf) for 5 min at 4 °C. Cell pellets were washed twice with 1× HBSS followed by centrifugation. After a final wash, cells were resuspended in 300 µL 1× HBSS, passed through a 35 μm cell strainer (Stellar Scientific, #FSC-FLTCP) to obtain a single cell suspension into a FACS tube. The single cell suspension was added with 1.5 µl Hoechst 33342 (Immunochemistry, #639) and taken to the fluorescence-activated cell sorting (FACS) facility on ice. To retrive live ECs, cells were sorted using an Aurora CS Sorter by gating GFP+ and DAPI- cells. Sorted cells were collected into 1.5 ml Eppendorf tubes containing 0.04% BSA in DPBST (Gibco, #14190-136).

ScRNAseq library preparation and sequencing

To count the cell number and viability of the sorted cells, 5 µl of sorted cell suspension was stained with trypan blue (Corning, #25-900-CI) and transferred onto a hemocytometer (Funakosh, #521-10). Viability of all our 4 cell samples was around 90% and cell concentrations were around 600 cells/µl. For each sample, about 16500 cells were added into a 10X Genomics Chromium Controller with a target recovery of 10000 cells per sample. The scRNAseq library preparation was completed with Chromium Next GEM Single Cell 3ʹ Reagent Kits (10X Genomics, PN-1000269) according to the protocol from the manufacturer. The genomic libraries were then sent to be sequenced by Next Generation Sequencing provided by Azenta.

ScRNAseq data analysis

The raw sequence data from Azenta was uploaded into 10X Genomics Cloud Analysis Server (https://www.10xgenomics.com/products/cloud-analysis) and annotated by aligning to the customized zebrafish genome reference “GRCz11_v4.3.2_cellranger_v6” ⁷⁰. The feature-barcode matrix derived from the Cell Ranger was downloaded and imported into R Studio. The following analyses were completed with R_v4.3.1 and Seurat_v4.1.3 ⁷¹. Data of 4 samples (2 wildtype and 2 mutant) were imported into R separately as Seurat objects and pre-processed to remove outliers with high feature number, RNA count, and mitochondrial gene percentage. Then, the feature-barcode matrices were normalized, and highly variable genes were identified, with which the data of four samples were integrated as one Seurat object. A customized cell cycle gene list for zebrafish was used to score each cell’s cell fate, and the difference between G2M and S phase scores was regressed out to eliminate the difference caused by cell cycle genes’ expressions. Next, cells were clustered by running RunPCA (npcs=40), RunUMAP (dims=1:40), FindNeighbours (dims=1:40), and FindClusters (resolution=0.5) in order. ECs were extracted by sub-setting cells which were both within kdrl/cdh5 enriched clusters and with kdrl/cdh5 expression levels >= 1. ECs were re-clustered, and marker genes of each cluster were obtained by Findmarkers. Putative names were assigned to EC clusters based on their marker genes and validated by our own fluorescent whole mount in-situ hybridization and expression data available online. Differentially expressed genes between wildtype and eng^mu130 mutants were obtained by Findmarkers for every cell cluster. Gene set enrichment analysis (GSEA) was performed by clusterProfiler ⁷², with gene lists obtained from Findmarkers and filtered by p_val <= 0.05 and ordered by their avg_log2FC.

In situ hybridization

Whole mount fluorescence in situ hybridization combined with EGFP antibody staining was performed using Tg(kdrl:EGFP)^s843 embryos as described previously ⁷³. Whole-mount in situ hybridization of zebrafish embryos was performed as described previously ⁷⁴. The plasmid for zebrafish aqp8a.1 was graciously provided by the lab of Dr. Saulius Sumanas (USF Health Heart Institute, Florida). Plasmids for zebrafish nkx2.3 were kindly provided by the lab Dr. Caroline Burns. Primer sequences for amplifying alk1 were kindly provided by the lab of Dr. Beth Roman (University of Pittsburgh, Pittsburgh). Previously described probes were cxcl12a, cxcl12b⁷⁵ and eng¹⁸. Probes for mrc1a were generated in-house with PCR products from cDNA with following primers:

mrc1a forward: GAGAACTGGGCTCATGCCACAG

mrc1a reverse: CCAGCAGTCTATTTGGCTATTCCC

Immunofluorescence for nucleoli

Embryos were fixed in 4% PFA for 1.5 hrs at room temperature, and then washed with PBST (PBS + 0.1% Tween20 (Fisher Scientific, #BP337-500)) 4 times of 5 min each. Next, embryos were washed once for 5 min with PBSTX (PBS + 0.1% Tween20 + 0.3% Triton X-100 (Fisher Scientific, #BP151-100)), followed by blocking in PBSTX + 10% BSA (Fisher Scientific, #BP1600-100) + 1% Sheep Serum (Sigma, #S2263) for 2 hrs. Embryos were then incubated with primary antibody, anti-fibrillarin (Santa Cruz, #SC-374022) diluted 1:50 in PBSTX + 1% BSA + 0.1% sheep serum, overnight at 4°C. On the following day, embryos were washed 6 times in PBSTX + 1% BSA + 0.1% sheep serum for 1 hr per wash. Then, embryos were incubated in secondary antibody, Alexa Fluor 546 (Invitrogen, #A-11003) diluted 1:1000 in PBSTX + 1% BSA + 0.1% sheep serum, overnight at 4°C. Embryos were finally washed 4 times in PBST for 10 min per wash.

Quantification of nucleoli volumes and numbers in ECs

Image processing and quantification were performed in Imaris (10.0.1). We pre-processed the fibrillarin channel to mask out signal from cell types other than ECs. To do so, a “Surface” object was created and fine-tuned based on the GFP channel from Tg(kdrl:EGFP)^s843. This provided a rough segmentation of the vasculature. The fibrillarin channel was masked by the above vessel “surface” with voxel intensities outside the surface set to 0 and voxels inside the surface kept at their original value. After this masking, most nucleoli staining outside of the vascular area was filtered out except some from cells neighbouring ECs due to imprecise vessel segmentation. To further suppress this interference, we applied channel arithmetic to create a new channel using the equation , where C1 is the EGFP channel representing ECs with the highest intensities located at nuclei, and C2 is the masked fibrillarin channel. With the above masking and channel arithmetic, we obtained a channel showing nucleoli staining exclusively in blood vessels. Another surface was created to segment the fibrillarin staining in channel C3. Volumes of each dense fibrillar component (DFC) were calculated by the surface object and organized together with the number of DFCs per cell.

Statistical analysis

All data were analyzed using GraphPad Prism or R packages. Graphs were plotted with mean standard deviation (s.d.). P<0.05 was considered statistically significant.

Code availability

All code used in this study is available from the authors upon request.

Author Contribution

Z.D., J.K. and A.F.S. conceived the experiments. Z.D., J.K. and E.G.T. performed the experiments. A.F.S. supervised the work. Z.D. and A.F.S. wrote the manuscript. All authors provided manuscript input and discussed and commented on the work.

Acknowledgement

The authors would like to thank the members of the zebrafish facility for fish maintenance.

Data Availability

Single cell sequencing data that support the findings of this study will be deposited in the NCBI GEO database.

Camelo C, Luschnig S (2021) Cells into tubes: Molecular and physical principles underlying lumen formation in tubular organs. Curr Top Dev Biol 143:37–74. 10.1016/bs.ctdb.2020.09.002
Queisser A, Seront E, Boon LM, Vikkula M (2021) Genetic Basis and Therapies for Vascular Anomalies. Circ Res 129:155–173. 10.1161/CIRCRESAHA.121.318145
Langille BL (1996) Arterial remodeling: relation to hemodynamics. Can J Physiol Pharmacol 74:834–841
Tuttle JL, Nachreiner RD, Bhuller AS, Condict KW, Connors BA, Herring BP, Dalsing MC, Unthank JL (2001) Shear level influences resistance artery remodeling: wall dimensions, cell density, and eNOS expression. American journal of physiology. Heart and circulatory physiology 281, H1380-1389
Baeyens N, Larrivee B, Ola R, Hayward-Piatkowskyi B, Dubrac A, Huang B, Ross TD, Coon BG, Min E, Tsarfati M, Tong H, Eichmann A, Schwartz MA (2016) Defective fluid shear stress mechanotransduction mediates hereditary hemorrhagic telangiectasia. J Cell Biol 214:807–816. 10.1083/jcb.201603106
Rodbard S (1975) Vascular caliber. Cardiology 60:4–49
Pries AR, Hopfner M, le Noble F, Dewhirst MW, Secomb TW (2010) The shunt problem: control of functional shunting in normal and tumour vasculature. Nat Rev Cancer 10:587–593. 10.1038/nrc2895
Siekmann AF (2023) Biology of vascular mural cells. Development 150. 10.1242/dev.200271
Ando K, Ishii T, Fukuhara S (2021) Zebrafish Vascular Mural Cell Biology: Recent Advances, Development, and Functions. Life (Basel) 11. 10.3390/life11101041
Tsuji-Tamura K, Ogawa M (2018) Morphology regulation in vascular endothelial cells. Inflamm Regen 38:25. 10.1186/s41232-018-0083-8
Vanlandewijck M, He L, Mae MA, Andrae J, Ando K, Del Gaudio F, Nahar K, Lebouvier T, Lavina B, Gouveia L, Sun Y, Raschperger E, Rasanen M, Zarb Y, Mochizuki N, Keller A, Lendahl U, Betsholtz C (2018) A molecular atlas of cell types and zonation in the brain vasculature. Nature 554:475–480. 10.1038/nature25739
Campinho P, Vilfan A, Vermot J (2020) Blood Flow Forces in Shaping the Vascular System: A Focus on Endothelial Cell Behavior. Front Physiol 11:552. 10.3389/fphys.2020.00552
Gifre-Renom L, Jones EAV (2021) Vessel Enlargement in Development and Pathophysiology. Front Physiol 12:639645. 10.3389/fphys.2021.639645
Gallione CJ, Richards JA, Letteboer TG, Rushlow D, Prigoda NL, Leedom TP, Ganguly A, Castells A, van Ploos JK, Westermann CJ, Pyeritz RE, Marchuk DA (2006) SMAD4 mutations found in unselected HHT patients. J Med Genet 43:793–797. 10.1136/jmg.2006.041517
Johnson DW, Berg JN, Baldwin MA, Gallione CJ, Marondel I, Yoon SJ, Stenzel TT, Speer M, Pericak-Vance MA, Diamond A, Guttmacher AE, Jackson CE, Attisano L, Kucherlapati R, Porteous ME, Marchuk DA (1996) Mutations in the activin receptor-like kinase 1 gene in hereditary haemorrhagic telangiectasia type 2. Nat Genet 13:189–195. 10.1038/ng0696-189
McAllister KA, Grogg KM, Johnson DW, Gallione CJ, Baldwin MA, Jackson CE, Helmbold EA, Markel DS, McKinnon WC, Murrell J et al (1994) Endoglin, a TGF-beta binding protein of endothelial cells, is the gene for hereditary haemorrhagic telangiectasia type 1. Nat Genet 8:345–351. 10.1038/ng1294-345
Roman BL, Pham VN, Lawson ND, Kulik M, Childs S, Lekven AC, Garrity DM, Moon RT, Fishman MC, Lechleider RJ, Weinstein BM (2002) Disruption of acvrl1 increases endothelial cell number in zebrafish cranial vessels. Development 129:3009–3019
Sugden WW, Meissner R, Aegerter-Wilmsen T, Tsaryk R, Leonard EV, Bussmann J, Hamm MJ, Herzog W, Jin Y, Jakobsson L, Denz C, Siekmann AF (2017) Endoglin controls blood vessel diameter through endothelial cell shape changes in response to haemodynamic cues. Nat Cell Biol 19:653–665. 10.1038/ncb3528
Banerjee K, Lin Y, Gahn J, Cordero J, Gupta P, Mohamed I, Graupera M, Dobreva G, Schwartz MA, Ola R (2023) SMAD4 maintains the fluid shear stress set point to protect against arterial-venous malformations. J Clin Invest 133. 10.1172/JCI168352
Genet G, Genet N, Paila U, Cain SR, Cwiek A, Chavkin NW, Serbulea V, Figueras A, Cerda P, McDonnell SP, Sankaranarayanan D, Huba M, Nelson EA, Riera-Mestre A, Hirschi KK (2024) Induced Endothelial Cell Cycle Arrest Prevents Arteriovenous Malformations in Hereditary Hemorrhagic Telangiectasia. Circulation 149:944–962. 10.1161/CIRCULATIONAHA.122.062952
Jin Y, Muhl L, Burmakin M, Wang Y, Duchez AC, Betsholtz C, Arthur HM, Jakobsson L (2017) Endoglin prevents vascular malformation by regulating flow-induced cell migration and specification through VEGFR2 signalling. Nat Cell Biol 19:639–652. 10.1038/ncb3534
Tual-Chalot S, Mahmoud M, Allinson KR, Redgrave RE, Zhai Z, Oh SP, Fruttiger M, Arthur HM (2014) Endothelial depletion of Acvrl1 in mice leads to arteriovenous malformations associated with reduced endoglin expression. PLoS ONE 9:e98646. 10.1371/journal.pone.0098646
Urness LD, Sorensen LK, Li DY (2000) Arteriovenous malformations in mice lacking activin receptor-like kinase-1. Nat Genet 26:328–331. 10.1038/81634
Park H, Furtado J, Poulet M, Chung M, Yun S, Lee S, Sessa WC, Franco CA, Schwartz MA, Eichmann A (2021) Defective Flow-Migration Coupling Causes Arteriovenous Malformations in Hereditary Hemorrhagic Telangiectasia. Circulation 144:805–822. 10.1161/CIRCULATIONAHA.120.053047
Singh E, Redgrave RE, Phillips HM, Arthur HM (2020) Arterial endoglin does not protect against arteriovenous malformations. Angiogenesis 23:559–566. 10.1007/s10456-020-09731-z
Braverman IM, Keh A, Jacobson BS (1990) Ultrastructure and three-dimensional organization of the telangiectases of hereditary hemorrhagic telangiectasia. J Invest Dermatol 95:422–427. 10.1111/1523–1747.ep12555569
Maung Ye SS, Kim JK, Carretero NT, Phng LK (2022) High-Throughput Imaging of Blood Flow Reveals Developmental Changes in Distribution Patterns of Hemodynamic Quantities in Developing Zebrafish. Front Physiol 13:881929. 10.3389/fphys.2022.881929
Santoso F, Sampurna BP, Lai Y-H, Liang S-T, Hao E, Chen J-R, Hsiao C-D (2019) Development of a simple ImageJ-based method for dynamic blood flow tracking in zebrafish embryos and its application in drug toxicity evaluation. Inventions 4:65
Bertrand JY, Chi NC, Santoso B, Teng S, Stainier DY, Traver D (2010) Haematopoietic stem cells derive directly from aortic endothelium during development. Nature 464:108–111. 10.1038/nature08738
Wakayama Y, Fukuhara S, Ando K, Matsuda M, Mochizuki N (2015) Cdc42 mediates Bmp-induced sprouting angiogenesis through Fmnl3-driven assembly of endothelial filopodia in zebrafish. Dev Cell 32:109–122. 10.1016/j.devcel.2014.11.024
Karthik S, Djukic T, Kim JD, Zuber B, Makanya A, Odriozola A, Hlushchuk R, Filipovic N, Jin SW, Djonov V (2018) Synergistic interaction of sprouting and intussusceptive angiogenesis during zebrafish caudal vein plexus development. Sci Rep 8:9840. 10.1038/s41598-018-27791-6
Kugler E, Snodgrass R, Bowley G, Plant K, Serbanovic-Canic J, Hamilton N, Evans PC, Chico T, Armitage P (2021) The effect of absent blood flow on the zebrafish cerebral and trunk vasculature. Vasc Biol 3:1–16. 10.1530/VB-21-0009
Larson JD, Wadman SA, Chen E, Kerley L, Clark KJ, Eide M, Lippert S, Nasevicius A, Ekker SC, Hackett PB, Essner JJ (2004) Expression of VE-cadherin in zebrafish embryos: a new tool to evaluate vascular development. Dev Dyn 231:204–213
Crist AM, Zhou X, Garai J, Lee AR, Thoele J, Ullmer C, Klein C, Zabaleta J, Meadows SM (2019) Angiopoietin-2 Inhibition Rescues Arteriovenous Malformation in a Smad4 Hereditary Hemorrhagic Telangiectasia Mouse Model. Circulation 139:2049–2063. 10.1161/CIRCULATIONAHA.118.036952
Leesch F, Lorenzo-Orts L, Pribitzer C, Grishkovskaya I, Roehsner J, Chugunova A, Matzinger M, Roitinger E, Belacic K, Kandolf S, Lin TY, Mechtler K, Meinhart A, Haselbach D, Pauli A (2023) A molecular network of conserved factors keeps ribosomes dormant in the egg. Nature 613:712–720. 10.1038/s41586-022-05623-y
Ochs RL, Lischwe MA, Spohn WH, Busch H (1985) Fibrillarin: a new protein of the nucleolus identified by autoimmune sera. Biol Cell 54:123–133. 10.1111/j.1768-322x.1985.tb00387.x
Vergara HM, Pape C, Meechan KI, Zinchenko V, Genoud C, Wanner AA, Mutemi KN, Titze B, Templin RM, Bertucci PY, Simakov O, Durichen W, Machado P, Savage EL, Schermelleh L, Schwab Y, Friedrich RW, Kreshuk A, Tischer C, Arendt D (2021) Whole-body integration of gene expression and single-cell morphology. Cell 184, 4819–4837 e4822. 10.1016/j.cell.2021.07.017
Maunsbach AB (1966) The influence of different fixatives and fixation methods on the ultrastructure of rat kidney proximal tubule cells. II. Effects of varying osmolality, ionic strength, buffer system and fixative concentration of glutaraldehyde solutions. J Ultrastruct Res 15:283–309. 10.1016/s0022-5320(66)80110-7
Schwarzmaier SM, Knarr MRO, Hu S, Erturk A, Hellal F, Plesnila N (2022) Perfusion pressure determines vascular integrity and histomorphological quality following perfusion fixation of the brain. J Neurosci Methods 372:109493. 10.1016/j.jneumeth.2022.109493
Bussmann J, Wolfe SA, Siekmann AF (2011) Arterial-venous network formation during brain vascularization involves hemodynamic regulation of chemokine signaling. Development 138:1717–1726. 10.1242/dev.059881
Chavkin NW, Genet G, Poulet M, Jeffery ED, Marziano C, Genet N, Vasavada H, Nelson EA, Acharya BR, Kour A, Aragon J, McDonnell SP, Huba M, Sheynkman GM, Walsh K, Hirschi KK (2022) Endothelial cell cycle state determines propensity for arterial-venous fate. Nat Commun 13. 10.1038/s41467-022-33324-7
Fang JS, Coon BG, Gillis N, Chen Z, Qiu J, Chittenden TW, Burt JM, Schwartz MA, Hirschi KK (2017) Shear-induced Notch-Cx37-p27 axis arrests endothelial cell cycle to enable arterial specification. Nat Commun 8. 10.1038/s41467-017-01742-7
Lee HW, Xu Y, He L, Choi W, Gonzalez D, Jin SW, Simons M (2021) Role of Venous Endothelial Cells in Developmental and Pathologic Angiogenesis. Circulation 144:1308–1322. 10.1161/CIRCULATIONAHA.121.054071
Red-Horse K, Siekmann AF (2019) Veins and Arteries Build Hierarchical Branching Patterns Differently: Bottom-Up versus Top-Down. BioEssays 41:e1800198. 10.1002/bies.201800198
Xu C, Hasan SS, Schmidt I, Rocha SF, Pitulescu ME, Bussmann J, Meyen D, Raz E, Adams RH, Siekmann AF (2014) Arteries are formed by vein-derived endothelial tip cells. Nature communications 5, 5758. 10.1038/ncomms6758
Li Q, Rycaj K, Chen X, Tang DG (2015) Cancer stem cells and cell size: A causal link? Semin Cancer Biol 35:191–199. 10.1016/j.semcancer.2015.07.002
Grimm L, Hogan BM (2021) Network patterning, morphogenesis and growth in lymphatic vascular development. Curr Top Dev Biol 143:151–204. 10.1016/bs.ctdb.2020.10.007
Chen Y, Zhao G, Zahumensky J, Honey S, Futcher B (2020) Differential Scaling of Gene Expression with Cell Size May Explain Size Control in Budding Yeast. Mol Cell 78:359–370e356. 10.1016/j.molcel.2020.03.012
Xie S, Swaffer M, Skotheim JM (2022) Eukaryotic Cell Size Control and Its Relation to Biosynthesis and Senescence. Annu Rev Cell Dev Biol 38:291–319. 10.1146/annurev-cellbio-120219-040142
Jin D, Zhu D, Fang Y, Chen Y, Yu G, Pan W, Liu D, Li F, Zhong TP (2017) Vegfa signaling regulates diverse artery/vein formation in vertebrate vasculatures. J Genet genomics = Yi chuan xue bao 44:483–492. 10.1016/j.jgg.2017.07.005
Mahmoud M, Allinson KR, Zhai Z, Oakenfull R, Ghandi P, Adams RH, Fruttiger M, Arthur HM (2010) Pathogenesis of arteriovenous malformations in the absence of endoglin. Circ Res 106:1425–1433. 10.1161/CIRCRESAHA.109.211037
Baeyens N, Nicoli S, Coon BG, Ross TD, Van den Dries K, Han J, Lauridsen HM, Mejean CO, Eichmann A, Thomas JL, Humphrey JD, Schwartz MA (2015) Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point. eLife 4. 10.7554/eLife.04645
Ouarne M, Pena A, Ramalho D, Conchinha N, Costa T, Figueiredo A, Saraiva M, Carvalho Y, Misikova L, Oh P, Franco CA (2023) A non-genetic model of vascular shunts informs on the cellular mechanisms of formation and resolution of arteriovenous malformations. bioRxiv, 2023.2008. 2021.554159
Alsina-Sanchis E, Garcia-Ibanez Y, Figueiredo AM, Riera-Domingo C, Figueras A, Matias-Guiu X, Casanovas O, Botella LM, Pujana MA, Riera-Mestre A, Graupera M, Vinals F (2018) ALK1 Loss Results in Vascular Hyperplasia in Mice and Humans Through PI3K Activation. Arterioscler Thromb Vasc Biol 38:1216–1229. 10.1161/ATVBAHA.118.310760
Ola R, Dubrac A, Han J, Zhang F, Fang JS, Larrivee B, Lee M, Urarte AA, Kraehling JR, Genet G, Hirschi KK, Sessa WC, Canals FV, Graupera M, Yan M, Young LH, Oh PS, Eichmann A (2016) PI3 kinase inhibition improves vascular malformations in mouse models of hereditary haemorrhagic telangiectasia. Nature communications 7, 13650. 10.1038/ncomms13650
Castel P, Carmona FJ, Grego-Bessa J, Berger MF, Viale A, Anderson KV, Bague S, Scaltriti M, Antonescu CR, Baselga E, Baselga J (2016) Somatic PIK3CA mutations as a driver of sporadic venous malformations. Sci Transl Med 8:332ra342. 10.1126/scitranslmed.aaf1164
Castillo SD, Tzouanacou E, Zaw-Thin M, Berenjeno IM, Parker VE, Chivite I, Mila-Guasch M, Pearce W, Solomon I, Angulo-Urarte A, Figueiredo AM, Dewhurst RE, Knox RG, Clark GR, Scudamore CL, Badar A, Kalber TL, Foster J, Stuckey DJ, David AL, Phillips WA, Lythgoe MF, Wilson V, Semple RK, Sebire NJ, Kinsler VA, Graupera M, Vanhaesebroeck B (2016) Somatic activating mutations in Pik3ca cause sporadic venous malformations in mice and humans. Sci Transl Med 8. 332ra343
Limaye N, Kangas J, Mendola A, Godfraind C, Schlogel MJ, Helaers R, Eklund L, Boon LM, Vikkula M (2015) Somatic Activating PIK3CA Mutations Cause Venous Malformation. Am J Hum Genet 97:914–921. 10.1016/j.ajhg.2015.11.011
Goncalves MD, Hopkins BD, Cantley LC (2018) Phosphatidylinositol 3-Kinase, Growth Disorders, and Cancer. N Engl J Med 379:2052–2062. 10.1056/NEJMra1704560
Angulo-Urarte A, Casado P, Castillo SD, Kobialka P, Kotini MP, Figueiredo AM, Castel P, Rajeeve V, Mila-Guasch M, Millan J, Wiesner C, Serra H, Muixi L, Casanovas O, Vinals F, Affolter M, Gerhardt H, Huveneers S, Belting HG, Cutillas PR, Graupera M (2018) Endothelial cell rearrangements during vascular patterning require PI3-kinase-mediated inhibition of actomyosin contractility. Nat Commun 9. 10.1038/s41467-018-07172-3
Snodgrass RO, Govindpani K, Plant K, Kugler EC, Doh C, Dawson T, McCormack LE, Arthur HM, Chico TJA (2023) Therapeutic targeting of vascular malformation in a zebrafish model of hereditary haemorrhagic telangiectasia. Dis Model Mech 16. 10.1242/dmm.049567
Wang X, Proud CG (2006) The mTOR pathway in the control of protein synthesis. Physiol (Bethesda) 21:362–369. 10.1152/physiol.00024.2006
Ruiz S, Zhao H, Chandakkar P, Papoin J, Choi H, Nomura-Kitabayashi A, Patel R, Gillen M, Diao L, Chatterjee PK, He M, Al-Abed Y, Wang P, Metz CN, Oh SP, Blanc L, Campagne F, Marambaud P (2020) Correcting Smad1/5/8, mTOR, and VEGFR2 treats pathology in hereditary hemorrhagic telangiectasia models. J Clin Invest 130:942–957. 10.1172/JCI127425
di Blasio L, Puliafito A, Gagliardi PA, Comunanza V, Somale D, Chiaverina G, Bussolino F, Primo L (2018) PI3K/mTOR inhibition promotes the regression of experimental vascular malformations driven by PIK3CA-activating mutations. Cell Death Dis 9. 10.1038/s41419-017-0064-x
Best DH, Vaughn C, McDonald J, Damjanovich K, Runo JR, Chibuk JM, Bayrak-Toydemir P (2011) Mosaic ACVRL1 and ENG mutations in hereditary haemorrhagic telangiectasia patients. J Med Genet 48:358–360. 10.1136/jmg.2010.088286
Clarke JM, Alikian M, Xiao S, Kasperaviciute D, Thomas E, Turbin I, Olupona K, Cifra E, Curetean E, Ferguson T, Redhead J, Genomics England Research C, Shovlin CL (2020) Low grade mosaicism in hereditary haemorrhagic telangiectasia identified by bidirectional whole genome sequencing reads through the 100,000 Genomes Project clinical diagnostic pipeline. J Med Genet 57:859–862. 10.1136/jmedgenet-2019-106794
Torring PM, Kjeldsen AD, Ousager LB, Brusgaard K (2018) ENG mutational mosaicism in a family with hereditary hemorrhagic telangiectasia. Mol Genet Genomic Med 6:121–125. 10.1002/mgg3.361
Westerfield M (1993) The Zebrafish Book. University of Oregon, Eugene, OR
Siekmann AF, Lawson ND (2007) Notch signalling limits angiogenic cell behaviour in developing zebrafish arteries. Nature 445:781–784. 10.1038/Nature05577
Lawson ND, Li R, Shin M, Grosse A, Yukselen O, Stone OA, Kucukural A, Zhu L (2020) An improved zebrafish transcriptome annotation for sensitive and comprehensive detection of cell type-specific genes. eLife 9. 10.7554/eLife.55792
Hao Y, Hao S, Andersen-Nissen E, Mauck WM 3rd, Zheng S, Butler A, Lee MJ, Wilk AJ, Darby C, Zager M, Hoffman P, Stoeckius M, Papalexi E, Mimitou EP, Jain J, Srivastava A, Stuart T, Fleming LM, Yeung B, Rogers AJ, McElrath JM, Blish CA, Gottardo R, Smibert P, Satija R (2021) Integrated analysis of multimodal single-cell data. Cell 184, 3573–3587 e3529. 10.1016/j.cell.2021.04.048
Wu T, Hu E, Xu S, Chen M, Guo P, Dai Z, Feng T, Zhou L, Tang W, Zhan L, Fu X, Liu S, Bo X, Yu G (2021) clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innovation (Camb) 2, 100141. 10.1016/j.xinn.2021.100141
Kochhan E, Siekmann AF (2012) Using zebrafish to study chemokine function. Methods in Molecular Biology
Hauptmann G, Gerster T (1994) Two-color whole-mount in situ hybridization to vertebrate and Drosophila embryos. Trends Genet 10. 10.1016/0168–9525(90)90008-t
Miyasaka N, Knaut H, Yoshihara Y (2007) Cxcl12/Cxcr4 chemokine signaling is required for placode assembly and sensory axon pathfinding in the zebrafish olfactory system. Development 134:2459–2468. 10.1242/Dev.001958

No competing interests reported.

Download PDF

Journal Publication

published 10 Dec, 2024

Read the published version in Angiogenesis →

Editorial decision: Revision requested
14 Jul, 2024
Reviews received at journal
09 Jul, 2024
Reviews received at journal
08 Jul, 2024
Reviewers agreed at journal
20 Jun, 2024
Reviewers agreed at journal
18 Jun, 2024
Reviews received at journal
17 Jun, 2024
Reviews received at journal
10 Jun, 2024
Reviewers agreed at journal
24 May, 2024
Reviewers agreed at journal
24 May, 2024
Reviewers invited by journal
24 May, 2024
Submission checks completed at journal
15 May, 2024
Editor assigned by journal
15 May, 2024
First submitted to journal
14 May, 2024

You are reading this latest preprint version

Alk1/Endoglin signaling restricts vein cell size increases in response to hemodynamic cues and limits ribosomal biogenesis

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Results

Changes in blood flow influence arterial diameters and EC sizes while veins respond less

Endoglin and Alk1 function cell autonomously to restrict venous EC size

Discussion

Methods

Live imaging and confocal microscopy

Tricaine treatments

Image processing

Vessel diameter, cell number and cell shape analysis

UMAP plots on cell shape parameters

Blastomere transplantations

EC isolation for single cell RNA sequencing

ScRNAseq library preparation and sequencing

ScRNAseq data analysis

In situ hybridization

Immunofluorescence for nucleoli

Quantification of nucleoli volumes and numbers in ECs

Statistical analysis

Declarations

Code availability

Author Contribution

Acknowledgement

Data Availability

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1