Creatine Suppressed Colitis-Associated Colorectal Cancer in C57BL/6 Mice through Regulating M1/M2 Macrophage Polarization and Gut Microbial Homeostasis

doi:10.21203/rs.3.rs-6455731/v1

Download PDF

Research Article

Creatine Suppressed Colitis-Associated Colorectal Cancer in C57BL/6 Mice through Regulating M1/M2 Macrophage Polarization and Gut Microbial Homeostasis

https://doi.org/10.21203/rs.3.rs-6455731/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Colitis-associated colorectal cancer (CAC) is a serious complication of inflammatory bowel disease (IBD) with complex etiology involving chronic inflammation, immune dysregulation, and gut microbiota dysbiosis. Creatine, a natural nitrogenous compound, possesses anti-inflammatory and immunomodulatory properties, but its role in CAC remains unclear. We utilized a mouse model of CAC induced by azoxymethane (AOM) and dextran sulfate sodium (DSS) in male C57BL/6 mice, and supplemented mice with creatine in drinking water. We assessed the effects of creatine on colitis severity, tumor burden, and histopathology. Additionally, we investigated the impact of creatine on gut barrier function, macrophage polarization, and gut microbiota composition. Creatine supplementation significantly alleviated DSS-induced colitis, reduced tumor burden, and delayed CAC progression in mice. Mechanistically, creatine improved gut barrier function by protecting tight junction proteins from degradation induced by the modeling stimulus, influenced macrophage polarization, and maintained gut microbiota diversity, promoting the abundance of beneficial bacteria while reducing harmful ones. Our findings suggest that creatine supplementation may represent a promising supportive therapy for IBD and CAC.

Colitis-associated colorectal cancer

Inflammatory bowel disease

Creatine

Macrophage polarization

Gut microbiota

Inflammatory bowel disease (IBD) refers to a group of recurrent, non-specific chronic gastrointestinal inflammatory disorders with unknown etiology, primarily including ulcerative colitis (UC), Crohn's disease, and indeterminate colitis. IBD is among the most common diseases of the digestive system, with a steadily increasing incidence worldwide, currently affecting approximately 6.8 million people globally(2020). Colitis-associated colorectal cancer (CAC) is a severe complication of IBD, with its pathogenesis closely related to chronic inflammation, tumor-associated macrophages (TAMs), and intestinal dysbiosis(Brennan and Garrett 2016; Wang et al. 2021). Prolonged colonic inflammation can increase the risk of colorectal cancer (CRC) by approximately 2-3 times(Lutgens et al. 2013).

Creatine is a nitrogenous compound that can be synthesized endogenously from arginine, glycine, and methionine, as well as being ingested through the diet(Ellery et al. 2016). Initially, creatine was used as a dietary supplement for athletes and was widely endorsed for its safety and efficacy by international sports organizations and regulatory agencies, including European Food Safety Authority (EFSA)(Kreider et al. 2017). In recent years, increasing attention has been paid to creatine’s non-energy-related properties. Emerging studies suggest that creatine may offer therapeutic benefits in various conditions, including metabolic disorders, colorectal cancer, and IBD(Rawson and Venezia 2011; Glover et al. 2013; Ellery et al. 2016).

Creatine exhibits several physiological effects, including anti-inflammatory, antioxidant, and immunomodulatory activities. However, its specific role in CAC has not been thoroughly investigated. This study aims to explore the role of creatine in the progression of CAC and to preliminarily elucidate its underlying mechanisms. Our findings indicate that dietary creatine supplementation in mice can inhibit azoxymethane (AOM)/ dextran sulfate sodium salt (DSS) induced CAC by modulating macrophage polarization and preserving gut microbiota diversity.

Animal experiments

Male C57BL/6 mice (6 weeks old) were purchased from HFK Bioscience (Beijing, China) and housed under controlled conditions (23±3°C; 12:12-h light:dark cycle). The mice were acclimated for one week before the experiment began. The CAC model (n=31, 6 in the control, 10 in the model and 15 in the treatment groups) was established by intraperitoneal injection of AOM (Yuanye, Shanghai, China) at a dose of 10 mg/kg body weight while the control group received an equivalent volume of normal saline via intraperitoneal injection. In the treatment group, 1% (m/m) creatine monohydrate (Solarbio, Beijing, China) was added to the drinking water throughout the entire experimental process. One week later, the animals in the model and treatment groups were given drinking water containing 2.5% DSS (MeilunBio, Dalian, China) for 7 days, followed by normal drinking water for 14 days. This cycle was repeated three times. During the DSS treatment, the body weights of the mice were measured daily, and their fecal conditions were recorded. The data were recorded twice a week when given normal drinking water. After the model was established, the surviving animals were included in the analysis. The mice were fasted for 12h and sacrificed by cervical dislocation. The entire colons and spleens were excised, the colon length and spleen weight were measured, and the number and size of colon tumers were quantified.

Animals that died at the beginning of modeling (7 died after intraperitoneal injection of AOM) or accidentally (1 died by biting itself) during the modeling process will be excluded.

Real-time PCR

Total RNA was extracted with TRIzol reagent (Thermo Fisher Scientific, Shanghai, China). Relative mRNA expression was determined by the 7500 Fast real-time PCR system (Applied Biosystems, Foster City, CA, USA) and SYBR Green (Thermo Fisher Scientific, Shanghai, China). The PCR procedure entailed an initial predenaturation step at 95°C for 20 s, followed by 40 cycles of amplification at 95°C for 1 s and 60°C for 20 s. The primer sequences used were as follows: forward, 5′-TTGCTGTTGAAGTCGCAGGAG-3′, reverse, 5- TGTGTCCGTCGTGGATCTGA-3′ for GAPDH; forward, 5′-ACTGAACTTCGGGGTGATCG-3′, reverse, 5′-CCACTTGGTGGTTTGTGAGTG-3′ for TNF-α; forward, 5′- TTCGGGCAGGCAGTATCACTCATTG -3′, reverse, 5′-ACACCAGCAGGTTATCATCATCATCC-3′ for IL-1β; forward, 5′-GGAGCCCACCAAGAACGATAGTC-3′, reverse, 5′-CACCAGCATCAGTCCCAAGAAGG-3′ for IL-6; forward, 5′-AGACTCCAGCCACACTCCAA-3′, reverse, 5′-AGTGGCGAGACCTACCTGTG-3′ for CXCL1; forward, 5′-TGCCAGGGTCACAACTTTACA -3′, reverse, 5′-CTCTCCACTGCCCCAGTTTT-3′ for iNOS; forward, 5′- GAAATGCCTGCCTATTGCCG -3′, reverse, 5′- TGAGCAATGTTCAAGGTCTGC -3′ for ARG1; forward, 5′- GGGCTACAGGAGAACCCAAC -3′, reverse, 5′- TGTACCGCACCCTCCATCTA -3′ for CD206; forward, 5′- CAGGTCCCTGTCATGCTTCT -3′, reverse, 5′- GTGGGGCGTTAACTGCATCT -3′ for MCP1 (Sangon, Shanghai, China). The mRNA expression was quantified using the comparative ΔCT method, with GAPDH as the reference gene.

Histology and immunohistochemistry

For histological evaluation, the colon tissue was Swiss rolled, fixed, dehydrated, and embedded in paraffin. Four-micron-thick sections were cut, deparaffinized, and stained with H&E. The stained slides were scanned via a high-throughput slide scanner. For the IHC assays, 4 μm sections were deparaffinized, antigen retrieval was performed via Tris-EDTA buffer, endogenous peroxidases were quenched with hydrogen peroxide, and the sections were blocked with 10% goat serum for 40 min, then incubation with first antibodies overnight at 4°C. After incubation with secondary antibodies for 30 min, the slides were developed with DAB for colorimetric visualization. First antibodies used in the study (zo-1, 21773-1-AP; occludin, 27260-1-AP; F4/80, 29414-1-AP) were purchased from Proteintech, Wuhan, China. The stained slides were scanned with a high-throughput slide scanner. The images were quantified via ImageJ 1.54f.

Transcriptomic analysis

The anal 1/3 segment of the mouse colon was excised, frozen in liquid nitrogen, and stored at -80°C. The transcriptomic analysis was conducted by Shenzhen BGI Genomics Co., Ltd. via the DNBSEQ platform, and data analysis and mining were performed using the Dr. Tom Multiomics data mining system.

16S rRNA sequencing

Cecal contents from the mice were collected, frozen in liquid nitrogen, and stored at -80°C. The sequencing was performed by Novogene Co., Ltd. via the NovaSeq6000 platform with PE250 read lengths. The 16S rRNA gene from the V3-V4 hypervariable regions of microbial DNA was amplified. For high quality clean tags, chimeric sequences were filtered by comparison with the Silva database, duplicates were removed, amplicon sequence variants were obtained and species annotation was performed. Further analyses included alpha diversity, beta diversity, and community difference analyses.

Statistical analysis

GraphPad Prism 9 was used for plotting and statistical analysis. Nonparametric tests were employed to determine significant differences between groups. The results are presented as the means ± SDs, with P <0.05 considered statistically significant, *P <0.05, **P <0.01, ***P <0.001.

To investigate the effects of creatine supplementation on CAC progression, we established an AOM/DSS-induced mouse model (Fig.1a). The AOM/DSS-treated model mice presented obvious clinical characteristics of colitis, such as colon length shortening, body weight loss, diarrhea, bloody stool and increased DAI scores during 3 cycles of DSS treatment. Compared with the model group, the creatine treatment group presented less distinct colon length shortening, weight loss, diarrhea and bloody stool, as indicated by significantly lower DAI scores (Fig.1b-d). Additionally, the treatment group had a lower spleen/body weight ratio than the model group did, suggesting a milder inflammatory response (Fig.1e). Furthermore, adenomas were observed in the distal colon, whereas the condition was improved in the creatine-treated group (Fig.1f). Compared with model mice, canine-treated mice presented a decreased number of tumors that were also smaller in size (Fig.1g,h). In addition, there was a greater proportion of smaller tumors in the treatment group (Fig.1i). The tumor burden in the treatment group was also significantly lower than that in the model group (Fig.1j). We performed H&E staining on Swiss roll sections of mouse colons (Fig.1k) and determined the most severe pathological grade in each sample. Fig.1l shows that highgrade dysplasia (HGD) predominated in the treatment group, whereas submucosal adenocarcinoma (SMA) predominated in the model group. These findings suggested that creatine supplementation could delay the progression of AOM/DSS-induced CAC.

Creatine improved colonic inflammation and intestinal barrier function in AOM/DSS-treated mice

The histological scores of the colons were evaluated according to the severity of inflammation, degree of inflammation infiltration, degree of tissue regeneration, and degree of crypt damage. Compared with those of the model group, the histological scores were significantly lower after creatine treatment (Fig.2a). Compared with those in the model group, the mRNA levels of the proinflammatory factors TNF-α, IL-1β, IL-6 and CXCL1 were significantly lower in the treatment group (Fig.2b-e). It has been reported that intestinal integrity plays important roles in suppressing tumorigenesis. Therefore, we performed immunohistochemical (IHC) staining to evaluate the expression of intestinal epithelial tight junction proteins, including zo-1 and occludin. Our data revealed that, compared with the model group, creatine treatment significantly alleviated the destruction of tight junction proteins caused by modeling (Fig.2f-i).

Taken together, these results suggest that creatine plays an important role in inhibiting AOM/DSS-induced colonic inflammatory responses and protecting gut barrier function during tumorigenesis.

Supplementation with creatine affects macrophage polarization and TAMs-related KEGG pathways

Transcriptomic analysis was conducted on colon tumor tissues from CAC mice. Compared with the other two groups, the model group presented a significantly greater number of differentially expressed genes (DEGs) , while the treatment group presented a relatively smaller number of DEGs compared with the NC group (Fig.3a,Fig.S1a). Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was performed to compare the groups. Although the KEGG pathway enrichment analysis involved various pathways in different fields for both groups, pathways such as energy metabolism, cell growth and death, and replication and repair were common to both groups (Fig.S1b,c). To highlight the pathways affected by creatine treatment, further KEGG pathway enrichment analysis was performed on common genes with opposite expression trends in both comparisons (Fig.3b). Among the 17 pathways, 10 were directly or indirectly associated with macrophage polarization and TAMs.

Creatine attenuated TAMs polarization

Macrophages play crucial regulatory roles in the progression of CAC; hence, we performed real-time PCR to assess the expression of macrophage markers in mouse colon tissues (Fig.4a-d). The levels of markers and products of M1 macrophages (iNOS, TNF-α, and IL-1β) in the model group were greater than those in the treatment group (Fig.2b,c and Fig.4a). However, the expression of markers of M2 macrophages (ARG1 and CD206) was also significantly greater in the model group (Fig.4b, c). Additionally, the TAMs marker MCP1, which is related to advanced tumors, also exhibited a relatively high expression level in the model group (Fig.4d). To determine whether the concurrent increase in M1 and M2 macrophage markers in the model group was due to an increase in the total number of macrophages, IHC staining for the total macrophage marker F4/80 was performed. The results revealed no significant difference in the total number of macrophages among the three groups (Fig.4e).

Creatine supplementation affected the diversity of the gut microbiota in mice

To investigate the effects of AOM/DSS modeling and creatine supplementation on the gut microbiota, we performed 16S rRNA sequencing on the cecal contents of the mice. Various common and unique gut microbiota were observed among the groups (Fig.5a). In the alpha diversity analysis of the gut microbiota, the model group presented significant reductions in both the Chao1 and Shannon indices compared with those of the control group, whereas creatine supplementation mitigated this effect (Fig.5b,c). Principal component analysis revealed significant differences in beta diversity between AOM/DSS-challenged mice and control mice (Fig.5d). Comparing the model and treatment groups, the similarity percentage (Simper) analysis at the phylum level indicated that Bacteroidota and Firmicutes were the main contributors to the intergroup differences (Fig.S2). Metagenome-Seq analysis further highlighted the specific differences between the treatment and model groups at the genus level; these genera included UCG-005, Frisingicoccus, Bilophila, Marvinbryantia, Mucispirillum, Acetatifactor, Escherichia-Shigella, Paludicola and Staphylococcus (Fig.5e).

The coordinated interactions among the intestinal epithelium, microbiota, and immune system play a critical role in maintaining intestinal homeostasis(Belkaid and Harrison 2017). Creatine is involved in the energy metabolism of IECs and is an important biomolecule for maintaining the barrier function of the intestinal epithelium. It is well known that tight junctions and adherens junctions, which are closely linked to the actin cytoskeleton, are significant energy consumers in the mucosa, with up to 25% of basal ATP used to maintain barrier function(Lee et al. 2018). In the cytoplasm, creatine is phosphorylated by creatine kinase (CK) to form phosphocreatine, which serves as a high-energy phosphate reservoir involved in ATP regeneration. Phosphocreatine is more diffusible than ATP, enabling efficient energy transfer to regions with high metabolic demand, such as sites of active actin remodeling(Guimarães-Ferreira 2014; Lee et al. 2018). In IBD patients, the expression level of CRT, the gene responsible for creatine transport, is significantly reduced, leading to a decrease in epithelial barrier function(Hall et al. 2020). Immunolocalization studies show that CRT is specifically expressed at tight junctions in IECs. Functional studies using intestinal epithelial cell lines with CRT overexpres-sion or targeted knockout further support that intracellular creatine is a critical driver of epithelial barrier formation and wound healing(Hall et al. 2020). In summary, disruption of the cellular energy balance due to creatine deficiency drives the development and progression of IBD, and creatine supplementation can alleviate this process.

Besides participating in energy metabolism to maintain intestinal epithelial barrier function, creatine and its analog, cyclocreatine, have been reported to inhibit tumor growth. Rapidly proliferating cancer cells demand high levels of energy to support continuous growth, and in this context, ener-gy depletion has been proposed as a potential strategy to limit tumor cell proliferation. Cyclocreatine can be phosphorylated by CK to generate phosphocyclocreatine, a compound that resists reverse catalysis and thus impairs ATP regeneration. This unique property has been associated with its inhibitory effects on tumor growth in both in vitro and in vivo models (Miller et al. 1993; Lillie et al. 1993; Kristensen et al. 1999). Creatine has also been shown to suppress the growth of various tumors, including rat mammary carcinomas, rat sarcomas, and human neuroblastoma in nude mice(Miller et al. 1993). Unlike cyclocreatine, creatine phosphate, the phosphorylated product of creatine, can be easily interconverted with creatine under the catalysis of creatine kinase, serving as the most common energy currency in cells. Therefore, it is likely that the anti-tumor effects of creatine are mediated through mechanisms beyond its role in energy metabolism, potentially involving signaling pathways related to inflammation, oxidative stress, or immune modulation.

In the transcriptomic analysis, creatine treatment significantly reduced the number of DEGs between the treatment and NC groups to approximately one-sixth of that observed between the model and NC groups (951 vs. 5537), indicating that creatine treatment effectively reversed the gene expression changes induced by the AOM/DSS modeling. To better highlight the impact of creatine treatment, we performed KEGG pathway enrichment analysis based on shared DEGs that exhibited opposite expression trends between the model vs. NC groups and the treatment vs. model groups. Among the 17 significantly enriched pathways (Q-value < 0.05), 9 were related to macrophage polarization and TAMs. Notably, the cytokine‒cytokine receptor interaction pathway plays a crucial role in shaping the tumor microenvironment, particularly in regulating the function of TAMs, which are major components of the tumor microenvironment. TAMs engage in complex interactions with tumor cells and other immune cells by secreting a variety of cytokines and chemokines, thereby influencing tumor initiation, progression, and immune evasion(Ge and Ding 2020). The IL-17 signaling pathway can both activate antitumor immunity and potentially accelerate tumor progression by promoting the immunosuppressive characteristics of TAMs through the regulation of their polarization, chemotaxis, and function. Cytokines, including IL-17, released by leukocytes infiltrating intestinal tumors can affect TAMs polarization and promote the growth of CRC cells by activating the STAT3 and NFκB signaling pathways(De Simone et al. 2015). In the pathogenesis of rheumatoid arthritis, breast cancer, and gastric cancer, macrophages play a pivotal role in driving disease progression(Tardito et al. 2019). Their migration, infiltration, and interaction with other immune cells are regulated by cell adhesion molecules and extracellular matrix (ECM)-receptor interactions (Hsieh et al. 2019; Evans et al. 2019; Rollins et al. 2025). The PPAR signaling pathway, a recent research focus, influences macrophage function by regulating lipid metabolism and inflammatory phenotype polarization(Wang et al. 2023). Arginine biosynthesis affects nitric oxide synthesis in macrophages, which is related to antimicrobial and inflammatory regulation. During proliferation and activation, macrophages require different arginine catabolic and transport systems(Yeramian et al. 2006; Yurdagul et al. 2020). Additionally, arginine also serves as a precursor for endogenous creatine synthesis(Wyss and Kaddurah-Daouk 2000).

Studies have reported that creatine transport and accumulation can reprogram the macrophage polarization by regulating cytokine responses(Ji et al. 2019; Yu et al. 2022). As key immune cells within the intestinal immune microenvironment, macrophages influence the gut environment by regulating cytokine, scavenging reactive oxygen spe-cies, and recognizing and engulfing pathogens(Hine and Loke 2019). M1 macrophages are primarily activated by LPS and interferon-γ, and are character-ized by high expression of CD68, CD86, and iNOS, along with the secretion of pro-inflammatory cytokines such as IL-1β and TNF-α(Muñoz et al. 2020). In contrast, M2 macrophages are activated by IL-4 and TGF-β, and express markers like CD206, CD68, and Arg1(Wang et al. 2017; Zhou et al. 2019). M1 macrophages primarily primarily mediate inflammation and phagocytosis, while M2 macrophages are involved in anti-inflammatory responses, tissue repair, and re-generation(Atri et al. 2018). Creatine supplementation has been reported to suppress M1 polarization by inhibiting the JAK2/STAT1 signaling pathway, while promoting M2 polarization (Li et al. 2022).

Theoretically, creatine inhibits the M1 polarization of macrophages while promoting M2 polarization. However, in our study, both M1 and M2 markers were elevated in the model group compared to the treatment group. Additionally, the expression of MCP1, a marker of TAMs in advanced cancers, was significantly increased in the model group. To further investigate this observation, we conducted IHC staining for F4/80, a general macrophage marker, and found no significant difference in the total number of mac-rophages among the three groups. These findings suggest that the differing proportions of TAMs between the model and treatment groups may account for the observed expression patterns. TAMs are known to accumulate in various tumors, including colon cancer (Szebeni et al. 2017; Mantovani et al. 2017). They can be classified into two functional subtypes: M1-like and M2-like. During the early stages of tumor development, TAMs tent to exhibit an M1-like phenotype, enhancing immune responses to kill tumor cells. In the later stages of tumor progression, however, TAMs usually switch to an M2-like phenotype, resulting in pro-tumor activity (Chanmee et al. 2014; Ngambenjawong et al. 2017). Therefore, the increased expression of M2 markers in the model group may reflect the predominance of M2-like TAMs at a later stage of tumor progression. Creatine may exert its protective effect against colorectal cancer by inhibiting the M2 polarization of TAMs and thereby limiting their pro-tumor activity.

Increasing evidence suggests that the gut microbiota plays a pivotal role in the growth and progression of colorectal cancer(Song et al. 2020; Song and Chan 2019). We found that creatine supplementation alleviated the reduction in gut microbiota diversity caused by AOM/DSS modeling. Simper analysis, which decomposes the Bray‒Curtis dissimilarity index, can quantify the contribution of each species to the differences between two groups. At the phylum level, Bacteroidota and Firmicutes, which are the main components of the gut microbiota and the primary producers of short-chain fatty acids (SCFAs)(Russo et al. 2019), made significant contributions. SCFAs are the main energy source for the colonic mucosa, accounting for more than 70% of the oxygen consumed in the colon, and play a crucial role in maintaining intestinal epithelial homeostasis(Roediger 1980; van der Beek et al. 2017). Further analysis via metagenome-Seq to assess intergroup differences at the genus level revealed that creatine treatment increased the abundances of UCG-005, Frisingicoccus, and Acetatifactor. Frisingicoccus is involved in SCFAs metabolism (David et al. 2014), whereas both UCG-005 and Acetatifactor have been reported to promote intestinal lipid absorption through the modulation of bile acid metabolism(Sun et al. 2022; Deng et al. 2025). This finding may help explain the reduced weight loss observed in the treatment group. Simultaneously, creatine treatment reduced the abundance of harmful bacteria, such as Bilophila, Marvinbryantia, Escherichia-Shigella, and Paludicola, which are associated with oxidative stress, disruption of intestinal barrier function, intestinal inflammation, and more severe diarrhea(David et al. 2014; Natividad et al. 2018; Guo et al. 2024; Niu et al. 2024; Delgadillo et al. 2025). In summary, in addition to its direct anti-inflammatory and antioxidant effects, creatine supplementation may help maintain intestinal epithelial homeostasis and inhibit the progression of CAC by regulating the gut microbiota.

Creatine, a widely recognized biomolecule, plays a crucial role in the energy metabolism of IECs, the reprogramming of macrophage polarization, and tumor progression. while IBD cannot typically be cured completely, supportive treatments can alleviate its symptoms, thereby improving the quality of life for patients. As a commonly used nutritional supplement, creatine has a decades-long history of use in athletes and individuals with sarcopenia and is considered effective and safe(Kreider et al. 2017). Our study revealed that creatine has a certain effect in reducing intestinal inflammation and inhibiting the progression of CAC. We believe that supplementation with creatine will also become a promising supportive treatment for IBD.

Creatine supplementation can inhibit CAC in AOM/DSS-induced mouse model. The underlying mechanisms likely include (1) alleviating inflammation and improving of gut barrier function by protecting tight junction proteins from degradation induced by the modeling stimulus; (2) regulating of M1/M2 macrophage polarization and inhibiting of TAMs-related KEGG pathways, and (3) maintaining of gut microbiota diversity and increasing of the abundance of beneficial bacteria while harmful ones. These findings suggest that creatine supplementation may be a promising supportive treatment for both IBD and CAC.

Supplementary Information: The supplementary figures can be downloaded at https://doi.org/10.6084/m9.figshare.28794662.

Author Contributions: Conceptualization, NL and JW; methodology, TN and NL; validation, NL; formal analysis, NL and TN; investigation,NL, WZ and ST; resources, JW and TN; data curation, TN; writing—original draft preparation, NL; writing—review and editing, TN and JW; visualization, NL; supervision, JW; project administration, TN; funding acquisition, JW All authors have read and agreed to the published version of the manuscript.

Funding: This work was supported by the National Key Research and Development Program of China (2022YFC3602105), Beijing Science and Technology Program (Z211100002921028), Capital’s Funds for Health Improvement and Research (CFH2022-2-2025 and 20200402085).

Institutional Review Board Statement: The animal study protocol was approved by the Institutional Review Board of Institutional Animal Care and Use Committee of Beijing Friendship Hospital (23-2025; 2023/06/29).

Data Availability Statement: The raw data and processed data of transcriptomic analysis are openly available in GEO at GSE293077. The raw data of 16S rRNA sequencing are openly available in SRA at PRJNA1241736.

Conflicts of Interest: The authors declare no conflicts of interest.

Atri C, Guerfali FZ, Laouini D (2018) Role of Human Macrophage Polarization in Inflammation during Infectious Diseases. Int J Mol Sci 19:. https://doi.org/10.3390/ijms19061801
Belkaid Y, Harrison OJ (2017) Homeostatic Immunity and the Microbiota. Immunity 46:562–576. https://doi.org/10.1016/j.immuni.2017.04.008
Brennan CA, Garrett WS (2016) Gut Microbiota, Inflammation, and Colorectal Cancer. Annu Rev Microbiol 70:395–411. https://doi.org/10.1146/annurev-micro-102215-095513
Chanmee T, Ontong P, Konno K, Itano N (2014) Tumor-associated macrophages as major players in the tumor microenvironment. Cancers (Basel) 6:1670–1690. https://doi.org/10.3390/cancers6031670
David LA, Maurice CF, Carmody RN, et al (2014) Diet rapidly and reproducibly alters the human gut microbiome. Nature 505:559–563. https://doi.org/10.1038/nature12820
De Simone V, Franzè E, Ronchetti G, et al (2015) Th17-type cytokines, IL-6 and TNF-α synergistically activate STAT3 and NF-kB to promote colorectal cancer cell growth. Oncogene 34:3493–3503. https://doi.org/10.1038/onc.2014.286
Delgadillo DR, Borelli JL, Mayer EA, et al (2025) Biological, environmental, and psychological stress and the human gut microbiome in healthy adults. Sci Rep 15:362. https://doi.org/10.1038/s41598-024-77473-9
Deng L, Zhong G, Yang H, Zhang B (2025) Anti-hypercholesterolemic effects of small-molecule pectin from Premna ligustroides Hemsl leaves: Modulation of inflammatory markers and gut microbiota in mice. Int J Biol Macromol 301:140381. https://doi.org/10.1016/j.ijbiomac.2025.140381
Ellery SJ, Walker DW, Dickinson H (2016) Creatine for women: a review of the relationship between creatine and the reproductive cycle and female-specific benefits of creatine therapy. Amino Acids 48:1807–1817. https://doi.org/10.1007/s00726-016-2199-y
Evans R, Flores-Borja F, Nassiri S, et al (2019) Integrin-Mediated Macrophage Adhesion Promotes Lymphovascular Dissemination in Breast Cancer. Cell Rep 27:. https://doi.org/10.1016/j.celrep.2019.04.076
GBD (2020) The global, regional, and national burden of inflammatory bowel disease in 195 countries and territories, 1990-2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet Gastroenterol Hepatol 5:17–30. https://doi.org/10.1016/S2468-1253(19)30333-4
Ge Z, Ding S (2020) The Crosstalk Between Tumor-Associated Macrophages (TAMs) and Tumor Cells and the Corresponding Targeted Therapy. Front Oncol 10:590941. https://doi.org/10.3389/fonc.2020.590941
Glover LE, Bowers BE, Saeedi B, et al (2013) Control of creatine metabolism by HIF is an endogenous mechanism of barrier regulation in colitis. Proc Natl Acad Sci U S A 110:19820–19825. https://doi.org/10.1073/pnas.1302840110
Guimarães-Ferreira L (2014) Role of the phosphocreatine system on energetic homeostasis in skeletal and cardiac muscles. Einstein (Sao Paulo) 12:126–131. https://doi.org/10.1590/s1679-45082014rb2741
Guo M, Fang L, Chen M, et al (2024) Dysfunction of cecal microbiota and CutC activity in mice mediating diarrhea with kidney-yang deficiency syndrome. Front Microbiol 15:1354823. https://doi.org/10.3389/fmicb.2024.1354823
Hall CHT, Lee JS, Murphy EM, et al (2020) Creatine Transporter, Reduced in Colon Tissues From Patients With Inflammatory Bowel Diseases, Regulates Energy Balance in Intestinal Epithelial Cells, Epithelial Integrity, and Barrier Function. Gastroenterology 159:984-998.e1. https://doi.org/10.1053/j.gastro.2020.05.033
Hine AM, Loke P (2019) Intestinal Macrophages in Resolving Inflammation. J Immunol 203:593–599. https://doi.org/10.4049/jimmunol.1900345
Hsieh JY, Keating MT, Smith TD, et al (2019) Matrix crosslinking enhances macrophage adhesion, migration, and inflammatory activation. APL Bioeng 3:016103. https://doi.org/10.1063/1.5067301
Ji L, Zhao X, Zhang B, et al (2019) Slc6a8-Mediated Creatine Uptake and Accumulation Reprogram Macrophage Polarization via Regulating Cytokine Responses. Immunity 51:272-284.e7. https://doi.org/10.1016/j.immuni.2019.06.007
Kreider RB, Kalman DS, Antonio J, et al (2017) International Society of Sports Nutrition position stand: safety and efficacy of creatine supplementation in exercise, sport, and medicine. J Int Soc Sports Nutr 14:18. https://doi.org/10.1186/s12970-017-0173-z
Kristensen CA, Askenasy N, Jain RK, Koretsky AP (1999) Creatine and cyclocreatine treatment of human colon adenocarcinoma xenografts: 31P and 1H magnetic resonance spectroscopic studies. Br J Cancer 79:278–285. https://doi.org/10.1038/sj.bjc.6690045
Lee JS, Wang RX, Alexeev EE, et al (2018) Hypoxanthine is a checkpoint stress metabolite in colonic epithelial energy modulation and barrier function. J Biol Chem 293:6039–6051. https://doi.org/10.1074/jbc.RA117.000269
Li Y, Jin X, Yang X, et al (2022) Creatine promotes the repair of peripheral nerve injury by affecting macrophage polarization. Biochem Biophys Res Commun 604:116–122. https://doi.org/10.1016/j.bbrc.2022.03.047
Lillie JW, O’Keefe M, Valinski H, et al (1993) Cyclocreatine (1-carboxymethyl-2-iminoimidazolidine) inhibits growth of a broad spectrum of cancer cells derived from solid tumors. Cancer Res 53:3172–3178
Lutgens MWMD, van Oijen MGH, van der Heijden GJMG, et al (2013) Declining risk of colorectal cancer in inflammatory bowel disease: an updated meta-analysis of population-based cohort studies. Inflamm Bowel Dis 19:789–799. https://doi.org/10.1097/MIB.0b013e31828029c0
Mantovani A, Marchesi F, Malesci A, et al (2017) Tumour-associated macrophages as treatment targets in oncology. Nat Rev Clin Oncol 14:399–416. https://doi.org/10.1038/nrclinonc.2016.217
Miller EE, Evans AE, Cohn M (1993) Inhibition of rate of tumor growth by creatine and cyclocreatine. Proc Natl Acad Sci U S A 90:3304–3308. https://doi.org/10.1073/pnas.90.8.3304
Muñoz J, Akhavan NS, Mullins AP, Arjmandi BH (2020) Macrophage Polarization and Osteoporosis: A Review. Nutrients 12:. https://doi.org/10.3390/nu12102999
Natividad JM, Lamas B, Pham HP, et al (2018) Bilophila wadsworthia aggravates high fat diet induced metabolic dysfunctions in mice. Nat Commun 9:2802. https://doi.org/10.1038/s41467-018-05249-7
Ngambenjawong C, Gustafson HH, Pun SH (2017) Progress in tumor-associated macrophage (TAM)-targeted therapeutics. Adv Drug Deliv Rev 114:206–221. https://doi.org/10.1016/j.addr.2017.04.010
Niu Y, Zhao T, Liu Z, et al (2024) Brassica rapa L. crude polysaccharide meditated synbiotic fermented whey beverage ameliorates hypobaric hypoxia induced intestinal damage. Food Funct 15:11975–11989. https://doi.org/10.1039/d4fo04667f
Rawson ES, Venezia AC (2011) Use of creatine in the elderly and evidence for effects on cognitive function in young and old. Amino Acids 40:1349–1362. https://doi.org/10.1007/s00726-011-0855-9
Roediger WE (1980) Role of anaerobic bacteria in the metabolic welfare of the colonic mucosa in man. Gut 21:793–798. https://doi.org/10.1136/gut.21.9.793
Rollins K, Fiaz S, Morrissey M (2025) Target cell adhesion limits macrophage phagocytosis and promotes trogocytosis. bioRxiv. https://doi.org/10.1101/2025.02.06.636906
Russo E, Giudici F, Fiorindi C, et al (2019) Immunomodulating Activity and Therapeutic Effects of Short Chain Fatty Acids and Tryptophan Post-biotics in Inflammatory Bowel Disease. Front Immunol 10:2754. https://doi.org/10.3389/fimmu.2019.02754
Song M, Chan AT (2019) Environmental Factors, Gut Microbiota, and Colorectal Cancer Prevention. Clinical Gastroenterology and Hepatology 17:275–289. https://doi.org/10.1016/j.cgh.2018.07.012
Song M, Chan AT, Sun J (2020) Influence of the Gut Microbiome, Diet, and Environment on Risk of Colorectal Cancer. Gastroenterology 158:322–340. https://doi.org/10.1053/j.gastro.2019.06.048
Sun J, Fan J, Li T, et al (2022) Nuciferine Protects Against High-Fat Diet-Induced Hepatic Steatosis via Modulation of Gut Microbiota and Bile Acid Metabolism in Rats. J Agric Food Chem 70:12014–12028. https://doi.org/10.1021/acs.jafc.2c04817
Szebeni GJ, Vizler C, Kitajka K, Puskas LG (2017) Inflammation and Cancer: Extra- and Intracellular Determinants of Tumor-Associated Macrophages as Tumor Promoters. Mediators Inflamm 2017:9294018. https://doi.org/10.1155/2017/9294018
Tardito S, Martinelli G, Soldano S, et al (2019) Macrophage M1/M2 polarization and rheumatoid arthritis: A systematic review. Autoimmun Rev 18:102397. https://doi.org/10.1016/j.autrev.2019.102397
van der Beek CM, Dejong CHC, Troost FJ, et al (2017) Role of short-chain fatty acids in colonic inflammation, carcinogenesis, and mucosal protection and healing. Nutr Rev 75:286–305. https://doi.org/10.1093/nutrit/nuw067
Wang H, Tian T, Zhang J (2021) Tumor-Associated Macrophages (TAMs) in Colorectal Cancer (CRC): From Mechanism to Therapy and Prognosis. Int J Mol Sci 22:. https://doi.org/10.3390/ijms22168470
Wang Y, Lin Y-X, Qiao S-L, et al (2017) Polymeric nanoparticles promote macrophage reversal from M2 to M1 phenotypes in the tumor microenvironment. Biomaterials 112:153–163. https://doi.org/10.1016/j.biomaterials.2016.09.034
Wang Z, Wang M, Xu X, et al (2023) PPARs/macrophages: A bridge between the inflammatory response and lipid metabolism in autoimmune diseases. Biochem Biophys Res Commun 684:149128. https://doi.org/10.1016/j.bbrc.2023.149128
Wyss M, Kaddurah-Daouk R (2000) Creatine and creatinine metabolism. Physiol Rev 80:1107–1213. https://doi.org/10.1152/physrev.2000.80.3.1107
Yeramian A, Martin L, Arpa L, et al (2006) Macrophages require distinct arginine catabolism and transport systems for proliferation and for activation. Eur J Immunol 36:1516–1526
Yu L, Wang L, Hu G, et al (2022) Reprogramming alternative macrophage polarization by GATM-mediated endogenous creatine synthesis: A potential target for HDM-induced asthma treatment. Front Immunol 13:937331. https://doi.org/10.3389/fimmu.2022.937331
Yurdagul A, Subramanian M, Wang X, et al (2020) Macrophage Metabolism of Apoptotic Cell-Derived Arginine Promotes Continual Efferocytosis and Resolution of Injury. Cell Metab 31:. https://doi.org/10.1016/j.cmet.2020.01.001
Zhou Z, Peng Y, Wu X, et al (2019) CCL18 secreted from M2 macrophages promotes migration and invasion via the PI3K/Akt pathway in gallbladder cancer. Cell Oncol (Dordr) 42:81–92. https://doi.org/10.1007/s13402-018-0410-8

No competing interests reported.

SupplementaryFigures.pdf

Download PDF

Reviewers invited by journal
02 Jun, 2025
Editor assigned by journal
18 Apr, 2025
Submission checks completed at journal
17 Apr, 2025
First submitted to journal
15 Apr, 2025

You are reading this latest preprint version

Creatine Suppressed Colitis-Associated Colorectal Cancer in C57BL/6 Mice through Regulating M1/M2 Macrophage Polarization and Gut Microbial Homeostasis

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Results

Discussion

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1