p75 Neurotrophin Receptor Shapes the Dynamics of Adult Hippocampal Neurogenesis in Alzheimer's Disease

doi:10.21203/rs.3.rs-7790527/v1

Download PDF

Research Article

p75 Neurotrophin Receptor Shapes the Dynamics of Adult Hippocampal Neurogenesis in Alzheimer's Disease

https://doi.org/10.21203/rs.3.rs-7790527/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background Alzheimer’s Disease (AD) is a neurodegenerative disorder primarily characterized by memory loss and cognitive decline. The AD-driven impairment of adult hippocampal neurogenesis - the process of generating new neurons in the dentate gyrus - is strongly implicated in this cognitive failure. Adult Neurogenesis is dependent on neurotrophin signaling, with the p75 pan-neurotrophin receptor (p75NTR) specific role to remain unclear under both physiological or pathological conditions. In the present study, we explore how p75NTR influences adult neurogenesis under both physiological and neurodegenerative conditions, focusing on AD. Methods We used the amyloidogenic 5xFAD mouse model of AD, as well as p75NTR full and conditional knockout mice. Moreover, we have generated a 5xFAD/p75NTR knockout model to directly examine the connective role of p75NTR in adult neurogenesis and AD. We have tempo-spatially evaluated the impact of p75NTR, by performing 5-bromo-2′-deoxyuridine injections to detect neural stem cell proliferation and immunohistochemistry analysis for key neurogenic markers. Additionally, transcriptomic profiling identified p75NTR-dependent gene networks. To extend findings to humans and provide translational relevance, we investigated p75NTR effects in human induced Pluripotent Stem Cells-derived Neural Stem Cells (iPSCs-derived NSCs), depicting receptor’s signaling in the presence of toxic Amyloid-β. Results Deletion of p75NTR in mice led to reduced NSC proliferation, altered differentiation, and decreased survival of neurons in the dentate gyrus, while our results from conditional knockout lines suggest that p75NTR regulates these processes through mechanisms extending beyond NSCs. Under AD and specifically in 5xFAD mice, neurogenesis was transiently increased at early stages but subsequently declined. This compensatory response was absent in 5xFAD/p75NTR mutants, which exhibited exacerbated deficits, indicating a p75NTR-dependent disease modification. Transcriptomic analyses revealed gene networks consistent with changes in proliferation, differentiation, and survival. Finally, in human iPSCs-derived NSCs, p75NTR expression was confirmed, and receptor inhibition significantly reduced amyloid-β–induced toxicity, pointing to conserved functions across species. Conclusions Together, these findings support a significant role for p75NTR in regulating hippocampal neurogenesis under both physiological and AD-related conditions. By linking p75NTR function to both rodent and human neural stem cell responses, this study highlights that p75NTR is not only critical for maintaining neurogenesis but also represents a candidate target for future therapeutic exploration in AD.

Hippocampal Adult Neurogenesis

p75 Neurotrophin Receptor

Alzheimer’s Disease

Dentate Gyrus

Neural Stem Cells

Human Neural Stem Cells

Alzheimer’s Disease (AD) is the most challenging neurodegenerative disease in terms of epidemiological penetrance and socioeconomical cost (1, 2). It is characterized by progressive cognitive impairment along with amyloid-β (Aβ) plaques deposition, tau tangles and synaptic dysfunction (3, 4). Despite decades of research strategies (5–7), targeting these late-stage aggregates has largely failed in clinical trials and this has underscored the urgent need to identify novel therapeutic targets.

Among these emerging targets, the lifelong generation of new neurons in the dentate gyrus, meaning the adult hippocampal neurogenesis, has gained considerable attention. This process supports learning, memory, and emotional regulation by enabling Neural Stem Cells (NSCs) to proliferate, differentiate, and functionally integrate into neural circuits (8–11). Additionally, impaired hippocampal neurogenesis has been linked to cognitive decline in AD (12–14), underscoring the importance of defining the mechanisms that regulate NSC proliferation and survival as a novel pharmacological approach for neurodegeneration.

Neurotrophins including NGF, BDNF, and NT3/4, are major regulators of neuronal survival and plasticity (15, 16). They primarily mainly through Trk receptors, but all neurotrophins also bind with the p75 pan-neurotrophin receptor (p75NTR) (17, 18). The last is broadly expressed during development (16, 19–21), however it becomes refined to specific brain regions during adulthood where it can promote either cell survival or cell death depending on cellular context and ligand availability (22–24). As a multifactorial receptor, p75NTR, is gaining particular interest as a "fate decision protein" in stem cells, modulating their potency and differentiation (25).

Despite growing attention, p75NTR’s role in adult hippocampal neurogenesis remains unclear, with contradictory results across genetic models (26–30). Given the critical role of adult hippocampal neurogenesis in maintaining cognitive function, p75NTR has increasingly been recognized as a contributing factor to neurodegenerative disorders, alongside with its pleiotropic effects on neuronal functions (31). Specifically in AD, p75NTR is upregulated in degenerating neurons and directly interacts with Aβ mediating either toxicity or protection (32–34). This duality makes p75NTR both intriguing and challenging as a potential therapeutic target.

However, the precise role of p75NTR in regulating NSC fate in vivo, under both physiological and Alzheimer’s disease conditions, remains poorly defined. Critically, it is unknown how its absence impacts the neurogenic process throughout AD progression, and whether its functions are conserved in human NSCs remains entirely unexplored.

To address these challenges, we used genetically modified mouse models at different ages to capture temporal aspects of AD pathology and neurogenesis. These included the amyloidogenic 5xFAD model (35), the full p75NTR knockout (p75NTRExIII) [firstly described by Lee et al. (36), and a crossbred 5xFAD/p75NTR knockout line, as well as a Nestin-Cre–driven conditional knockout to study cell-autonomous effects in NSCs. In parallel, we used human induced pluripotent stem cell (hiPSC)-derived NSCs(37) to assess p75NTR’s role in regulating proliferation and Aβ toxicity in a human context. Finally, we applied transcriptomics to identify gene networks regulated by p75NTR.

Through this combined in vivo models and human stem cell approach, we provide a detailed spatiotemporal characterization of p75NTR function in adult hippocampal neurogenesis under both physiological and AD conditions. Our findings highlight p75NTR as a regulator of hippocampal neurogenesis relevant to AD pathophysiology and as a candidate pathway for future therapeutic investigation.

Mice

Wild-type (WT), p75NTR ko, p75 fl/fl NestinCre, 5xFAD and 5xFAD/p75NTR ko male and female mice of different ages (2, 4 and 6-months old) were used. p75NTR ko mice (Ngfrtm1Jae ExonIII) and 5xFAD heterozygous mice (#002213 and #034848-JAX, respectively) were maintained on a C57BL/6 background. The p75fl/fl mice (ExonII floxed, Ngfrtm1a(EUCOMM)Wtsi) were crossed with Nestin-Cre transgenics. 5xFAD mice express human APP (Swedish K670N/M671L, Florida I716V, London V717I) and PSEN1 (M146L, L286V) mutations (35), and 5xFAD/p75NTR ko mice were generated by crossing 5xFAD and p75NTR heterozygotes. All animals were housed at IMBB-FORTH, Crete, under standard conditions and in compliance with Greek Government and FORTH ethics guidelines.

BrdU labelling

BrdU i.p. injections 100mg/kg (10mgr/ml-Sigma, St. Louis, MO, USA, B5002) were performed for 5 days (1 injection per day). Analysis was performed either immediately after the BrdU injections (assessment of proliferation) or after 21 days (assessment of survival).

Tissue processing

Mice were anesthetized, trans-cardially perfused with saline and the brains have been dissected. The right hemispheres were further dissected and hippocampal specimens were stored in − 80⁰C for RNA isolation. The left hemispheres were post-fixed by 4% paraformaldehyde (158127, Sigma) overnight at 4⁰C. They were stored in cryoprotective medium (15% sucrose/7,5% gelatine) at − 80⁰C, until they processed for coronal sections. Coronal sections of 40µM were cut in the dorsoventral axis of hippocampus (from bregma − 4mm to -1mm).

Immunohistochemistry

Cryosections were permeabilized by immersion in ice-cold acetone at 20°C for 5 min and washed with 0.1% Triton X-100 in 1xPBS for 15 min and 0.3% Triton X-100 in 1xPBS for 30 min, then blocked for 1hr in 10% donkey serum (S30, Millipore, Burlington, MA, USA) containing 0.1% Triton X-100 in 1xPBS and 0.1% BSA, and incubated overnight at 4⁰C with the above primary antibodies (Table 1). Slides were then washed and incubated with the appropriate fluorochrome-labeled secondary antibodies at room temperature (Table 1). Cell nuclei were visualized with Hoechst (1:10.000, H3570, Invitrogen, Carlsbad, CA, USA). Slides were covered with VECTASHIELD® Antifade mounting medium (VECTOR, Newark, CA, USA) and images were photographed via confocal microscopy (SP8 Leica, Wetzlar, Germany). For double labelling and the detection of BrdU-labeled nuclei, specimens have been previously incubated in 2N HCl at 37⁰C, followed by two rinses with PBS before blocking step.

Table 1

List of primary and secondary antibodies used in Immunohistochemistry-Immunofluorescence and Western blot assay.
Antibody	Supplier	Catalogue Number	Dilution	Use
Anti-BrdU	Abcam	Ab1893	1:100	IHC, IF
Anti-Sox₂	Cell signaling	2748	1:100	IHC
Anti-DCX	Abcam	207175	1:100	IHC
Anti-NeuN	Millipore	MAB377	1:100	IHC
Anti-cleaved caspase3	Cell signaling	9661	1:300	IHC
Anti-p75NTR	Biolegend	839701	1:1000	WB
Anti-p75NTR (MC192)	Abcam	ab6172	1:100	IP
Anti-RIP2	Enzo Life Sciences	ADI- AAP-460	1:1000	WB
Anti-TRAF6	Abcam	ab33915	1:2000	WB
Anti-actin	Santa Cruz Biotechnology	sc-47778	1:2000,	WB
Anti-mouse Alexa Fluor 488	Invitrogen	A11029	1:500	IHC, IF
Anti-rabbit Alexa Fluor 555	Invitrogen	A10040	1:500	IHC, IF
Anti-sheep Alexa Fluor 647	Jackson ImmunoResearch	713-605-003	1:500	IHC, IF
HRP Anti-mouse IgG	Millipore	AP- 124P	1:5000	WB
HRP Anti-rabbit IgG	Invitrogen	65-6120	1:5000	WB

Cell counts and quantification

Cell counts and quantification are based on a modified unbiased stereology protocol. Seven out of every 10 adjacent sections were chosen (covering the whole DG area of the hippocampus) and processed for immunohistochemistry. The number of BrdU⁺, Sox2⁺, Dcx⁺, NeuN⁺ and caspase⁺ cells was then counted under ×40 magnification under a fluorescent microscope (Leica sp8) at the area of hippocampal DG of a total of 7 sections and the average number of cells was estimated. The mean was then multiplied with the total number of sections (75 per mouse) to estimate the total number of cells per DG.

Generation and Culture of Human Neural Stem Cells (hNSCs)

iPSCs were reprogrammed from skin fibroblasts of two healthy human lines (SFC856-03-04, SFC841-03-01) that were kindly provided by Dr Μ. Z. Cader and used for the generation of neural progenitor cells, as previously described in (38). Briefly, iPSCs colonies were cultured on mouse embryonic fibroblasts (MEFs), in a medium that consisted of DMEM-F12 (21331-020, Gibco, Carlsbad, CA, USA), 20% (v/v) Knockout Serum Replacement (10828028, Gibco), 1% non-essential amino acids (NEAA; 11-140-050, Gibco), 1% penicillin/streptomycin (PAA; 15140122, Gibco), L- Glutamine (A2916801, Gibco), 2-Mercaptoethanol (31350010, Gibco) supplemented with 5 ng/ml FGF2 (100-18C, Peprotech, Cranbury, NJ, USA). Next, iPSC colonies were detached from MEFs with 2 mg/mL collagenase IV (C1764, Sigma) and resuspended in the same medium without FGF2, supplemented with 1 µM Dorsomorphin (ab120843, Abcam, Cambridge, UK), 3 µM CHIR99021 (SML1046, Sigma), 10 µM SB-431542 (72232, Stem Cell Technologies, Vancouver, BC, Canada) and 0.5 µM Purmorphamine (72202, Stem Cell Technologies). Embryoid bodies (EBs) were formed and medium was changed to N2B27 medium (1:1 Neurobasal (21103-049, Gibco) and DMEM-F12 medium, supplemented with N2 supplement (17502048, Gibco) and B27 supplement lacking vitamin A (12587010, Gibco), and 1% penicillin/streptomycin supplemented with the aforementioned small-molecules. On day 4, dorsomorphin and SB-431542 were removed, whereas 150µM L-Ascorbic acid (A4544, Sigma) was added to the medium. On day 6, the spheres were cut into smaller pieces and plated on Matrigel-coated plates (354263, Corning, NY, USA). When confluent, cells were split via treatment with accutase (A6964, Sigma). The identity of the cells was verified via immunocytochemistry for NESTIN (151 NB100-1604, BioTechne, Minneapolis, MN, USA). The generated NSCs can be expanded and cryopreserved enabling long-term, repetitive studies.

Immunoprecipitation and Immunoblotting

Cells were suspended in Pierce™ IP Lysis Buffer (87788, Thermo Fischer Scientific, Waltham, MA, USA) supplemented with protease inhibitors (539138, Calbiochem, Burlington, MA, USA) and phosphatase inhibitors (524629, Calbiochem). Lysates were pre-cleared for 1h with protein G-plus Agarose beads (sc-2002, Santa Cruz Biotechnology, Dallas, TX, USA) and immunoprecipitated with p75NTR antibody overnight at 4⁰C. Protein G-plus agarose beads were incubated with the lysates for 4h at 4⁰C via gentle shaking. Beads were collected via centrifugation, re-suspended in 2× SDS loading buffer and subjected to Western blot analysis against TRAF6 antibody. For immunoblot (IB) analysis, the beads were suspended in sodium dodecyl sulfate-loading buffer and separated through SDS-PAGE. Proteins were transferred to nitrocellulose membranes and blotted with the corresponding antibodies for RIP2, p75NTR, TRAF6 and Actin (Table 1). Immunoblots were developed using the ECL Western Blotting Kit (ThermoFisher Scientific), and Image analysis and quantification of band intensities were performed with ImageJ Software. For the immunoprecipitation assay, the analysis was derived from the immunoprecipitated fraction relative to the total fraction.

Preparation of Aβ Oligomers

Amyloid-β (1–42) peptide was purchased from AnaSpec (AS-20276, AnaSpec, Fremont, CA, USA) and prepared according to manufacturer’s instructions. For Aβ treatment, Aβ oligomers were prepared according to previously described protocols (39, 40), and they were diluted in DMEM at the specified concentrations. Human NSCs were treated with 10µΜ for 48 hours.

Cell Tox Assay

After 24h of treatments, we used the CellTox™ Green Cytotoxicity Assay kit (G8742, Promega Corporation, Madison, WI, USA) to assess the survival of hNSCs in the presence or absence of p75NTR inhibitor MC-192 (2.5 ng/mL, ab6172, Abcam). AD pathology was mimicked by treating the human NSCs with Aβ-amyloid peptides (10µΜ of Aβ1–42 oligomers) and after 24hours we used cell tox assay for another 24h. Dead cells were then counted with a fluorescent microscope at 485–500nm Ex. CellTox assay reagents and Hoescht (1:10,000, H3570, Invitrogen) were added to each well for 30 min, and cells were imaged using a fluorescent microscope (Zeiss AXIO Vert A1, Zeiss, Oberkochen, Germany). Positive cells for cell tox reagent were normalized to reflect the total number of cells per image.

5-bromo-2′-deoxyuridine (BrdU) assay in hiPSCs-derived NSCs

iPSCs-derived NSCs were cultured on Matrigel for 24h with or without treatment of p75NTR inhibitor (ab6172, abcam MC-192, 2,5ng/ml). After 24h the cells were pulsed with 1µM BrdU for 4 hours and fixed with 4% PFA for subsequent immunostaining for BrdU and Hoechst for nuclear labeling.

Isolation of RNA & Sequencing

Total RNA from biological triplicates (hippocampal specimens of p75NTR ko, 5xFAD, 5xFAD/p75NTR ko and WT mice of 2 months old, that have been dissected after the BrdU injections) was extracted using Trizol reagent (15596018, Thermo Scientific) as per the manufacturer’s protocol. The quantity and quality of RNA samples were analyzed using Agilent RNA 6000 Nano kit with the bioanalyzer from Agilent. RNA samples with RNA integrity number (RIN) > 7, were used for library construction using the 3′ mRNA-Seq Library Prep Kit FWD for Illumina (QuantSeq-LEXOGEN, Vienna, Austria) as per the manufacturer’s instructions. Amplification was controlled for obtaining optimal unbiased libraries across samples by assessing the number of cycles (14) required by qPCR. DNA High Sensitivity Kit for bioanalyzer was used to assess the quantity and quality of libraries, according to the manufacturer’s instructions (Agilent, Santa Clara, CA, USA). Libraries were multiplexed and sequenced on an Illumina Nextseq 2000 at the genomics facility of IMBB FORTH according to the manufacturer’s instructions.

Differential Expression and GO enrichment analysis

The quality of the raw sequences in the output FASTQ files was assessed with the FastQC software [www.bioinformatics.babraham.ac.uk/projects/fastqc/]. Reads were aligned to the mouse (mm10) genome using the Hisat2 aligner (parameters used: hisat2 -p32 -x $REFERENCE_GENOME -q fastq/ $FILE_ID.fastq -S $FILE_ID.sam --score-min L,0,-0.5) (41). The BAM files were sorted by genomic coordinates and indexed using samtools (42). Htseq-count was utilized to summarize reads at the gene level (parameters used: htseq-count -f bam -s yes -i gene_id bam $FILE_ID.bam $REFERENCE_ANNOTATION >$COUNTS_DIR/NGS$FILE_ID) (43). Differential expression analysis (DEA) was conducted using EdgeR (44). Two designs were employed, both accounting for gender differences between the mice (gender included as a covariate). The first design also included disease and genotype as covariates (~ disease + genotype + gender), with healthy WT mice treated as the reference. The second design accounted for mouse line as a group covariate (~ group + gender, groups: WT, 5xFAD, p75NTR ko, 5xFAD/p75NTR ko), with WT mice as the reference. Differentially expressed genes (DEGs) were identified using a significance threshold of adjusted p-value (padj) < 0.05. Enrichment analysis was performed using the Metascape web tool (enrichment p-value set to 0.05) (45). Gene Set Enrichment Analysis (GSEA) tool was also used, to analyze the functional changes in gene expression across genotype (p75NTR ko vs WT) and between 5xFAD and 5xFAD/p75NTR ko samples, as specified by Broad GSEA package using default parameters (46). GO-BP pathways were tested (https://www.gsea-msigdb.org/gsea/msigdb/mouse/genesets.jsp?collection=GO:BP) against a ranked lists of descending LFCs for both contrasts, and we selected some positive hits for display. The volcano and bubble plots were created in R with custom in-house scripts (available upon request).

Reverse Transcriptase PCR & Quantitative PCR

cDNA was synthesized by the total RNA, using the High-Capacity cDNA Reverse Transcription kit (4368814, Thermo Fisher) according to the supplier protocols. Primers for Ngfr, were designed using the NCBI Primer BLAST software (Forward:AGAGAAACTGCACAGCGACA, Reverse:CCATCACCCTTGAGGGCTTG), to detect an area inside the coding sequence of the gene. More specifically, the primer pair was designed as such to amplify specifically the area between exons V and VI (between TMD – Transmembrane Domain and DD – Death Domain). Primers for mouse GAPDH, were also designed to be used as a control sample (Forward: ATTGTCAGCAATGCATCCTG, Reverse: ATGGACTGTGGTCATGAGCC). To run the quantitative RT-PCR, we used 1 µL of cDNA (10 ng/µL) and the KAPA SYBR Fast kit (KK4601, Sigma) according to the supplier’s instructions. The cycling program consisted of 20 s at 95°C, followed by 40 cycles of 95°C for 3 s and 60°C for 30 s on a StepOne Real-Time PCR System (Thermo Fisher Scientific). After the completion of qPCR, a melt curve of the amplified products was performed. The housekeeping gene GAPDH was used to normalize the expression levels between the different conditions. Data were collected and analyzed using the StepOne Software v2.3 (Thermo Fischer Scientific).

Statistical Analysis

All values are expressed as the mean ± SEM. Student’s t-test was used for the comparison of two groups, and one-way or two-way ANOVA were used for multiple group comparisons. A p < 0.05 was considered to mark statistical significance. Statistical analysis was performed using GraphPad Prism 7 (GraphPad Software Inc., San Diego, CA, USA).

p75NTR is a key regulator of NSC proliferation

To test the effect of p75NTR deficiency on the proliferation of NSCs in adult mice, we compared the number of BrdU and Sox2 positive cells at the DG of the hippocampus in WT and p75NTR ko mice. The deletion of p75NTR in the ko mice was identified by the absent expression of the receptor in the Basal Forebrain after immunohistochemical staining using primary antibody for p75NTR (Supplemental Fig. S1).

Coronal sections of hippocampal DG from WT and p75NTR ko mice were co-immunostained with BrdU and Sox2 primary antibodies and analysis showed that the number of proliferative NSCs was significantly decreased in the p75NTR ko mice [from 1011.25 ± 66.3 cells (SEM) to 530.5 ± 63.6 cells (SEM)] (Fig. 1A, B), corresponding to a 47.5% decrease. Thus, these results indicate that the expression of p75NTR is necessary for the proper proliferation of NSCs in the adult mice of 2 months old. By repeating this experimental approach at 4- and 6-months old mice, we observed that the deficiency of p75NTR in 4 months old mice, still has a significant effect on the proliferation rates reducing their numbers from 765 ± 38.2 cells (SEM) in WT to 489.5 ± 35 cells (SEM) in p75NTR ko mice (Fig. 1A, B). On the other hand, in 6 months old mice there were no significant differences since the proliferation of NSCs diminishes to such an extent (approximately around 75%) at this age that no significant effect can be detected.

Impairment of neuronal maturation in p75NTR deficient mice

Following the proliferation capacity of NSCs upon p75NTR deficiency, we explored the differentiation of NSCs of the hippocampal DG towards the production of immature neurons at the age group of 2, 4 and 6 months old, by studying the number of Doublecortin (Dcx) positive cells, a protein marker depicting immature neurons. To our surprise, the analysis showed significantly increased number of immature neurons in the p75NTR ko mice compared to the WT [from 9410 ± 207 cells (SEM) to 1267.6 ± 949.7 cells (SEM) in p75NTR ko mice] (Fig. 1C, D). Furthermore, the area of Dcx⁺ cells’ processes was also significantly increased in p75NTR ko mice (Supplemental Fig. S2). Thus, the reduction of proliferation that was observed in 2 months old p75NTR ko mice resulted in the significant increase of immature neurons, indicating a robust maturation process forced by the lack of p75NTR expression. This receptor is known to regulate cell cycle progress (47, 48) and this action could explain the increased maturation rates in NSCs. Moreover, we studied the effect of p75NTR deletion in NSC differentiation in 4- and 6-months old mice (Fig. 1C, D), where we found no significant differences. As expected, the number of Dcx⁺ cells in 6 months old mice was reduced compared to this of 2 months old mice (approximately around 75%) following the same pattern with the proliferation procedure.

Reduction of neuronal maturation in the p75NTR ko mice

To further evaluate the hypothesis of p75NTR-mediated cell cycle deterioration, we also investigated the production of fully mature neurons at 2 months old mice. For that reason, we pulsed mice with BrdU for the first 5 days of a 3-week period and after 21 days overall we sacrificed the mice and studied the number of BrdU⁺ and NeuN⁺ (Neuronal nuclear marker of mature neurons) cells that survived. Our analysis showed that the number of both positive cells in the DG was significantly decreased in p75NTR ko mice compared to the WT [from 553.3 ± 37.2 cells (SEM) to 319.17 ± 35.1 cells (SEM) in p75NTR ko mice] (Fig. 1E, F). Thus, p75NTR is necessary not only for proper differentiation of neuronal precursors to immature neurons, but it also determines the final number of fully mature neurons by driving immature neurons to "freezing” state. In order to specify if this decreased number of NeuN⁺ cells is due to the inability of Dcx⁺ neurons to further differentiate or cells are more vulnerable, we measured cell death in hippocampal DG. We stained and counted the caspase-3 positive cells, and we revealed that there is a significantly increased number of cell death under p75NTR deletion [from 45.83 ± 4.1 cells (SEM) to 131.87 ± 6.15 cells (SEM) in p75NTR ko mice] (Fig. 1G, H). Contradictory to receptor’s well known pro-apoptotic effects, we here show that its expression is important for the proper differentiation and maturation of NSCs, by sustaining their survival rates in addition to cell cycle control.

Genes differential expression analysis confirmed the neurogenic capacity of p75NTR

To identify the gene networks underlying the role of p75NTR in adult neurogenesis, we performed RNA sequencing on hippocampal tissue obtained from WT mice, p75NTR ko, and a newly generated mouse line upon crossing of 5xFAD with the p75NTR ko mice, the 5xFAD/p75NTR ko (with the WT group serving as the reference). This bioinformatic analysis revealed 9 significantly upregulated and 33 significantly downregulated genes, as visualized in the volcano plot (Fig. 2A). Gene Ontology (GO) and pathway enrichment analyses revealed that these differentially expressed genes (DEGs) are significantly involved in biological processes such as the regulation of neurogenesis, axonogenesis, cell growth and cell migration (Fig. 2B), confirming the biological results from the in vivo studies. Genes and GOs are detailed in Supplemental Excel Table S1.

A heatmap representing the expression patterns of all 42 DEGs is shown in Fig. 2C, highlighting several genes with known roles in proliferation and migration. For instance, Med1 is involved in the induction of cell proliferation and migration and regulates BDNF levels (49), while Msl1 contributes to cell cycle progression (50). Fabp7 promotes proliferation and survival via the MEK/ERK signaling pathway (51), and deletion of Fxr1 has been shown to impair neurogenesis by reducing cell proliferation in the dentate gyrus (52). Additionally, Cdh1 plays a critical role in regulating neurogenesis and cortical development (53), and, together with Fzr, promote neural stem cell differentiation in Drosophila (54). Conversely, genes such as Sv2a were identified for their role in supporting NSC survival through the p53 signaling pathway (55).

It is of special notice that the Ngfr gene was found to be upregulated in both p75NTR ko and 5xFAD/p75NTR ko mice (Fig. 2A, C), indicating the important functions of this receptor since its expression levels are induced as a result of its loss of function. It could also be suggested that the receptor’s intracellular part remaining after exon III deletion has potential signaling properties that contribute or opposing its extracellular functions. This upregulation was validated via qRT-PCR (Supplemental Fig. S3), with results presented as logarithmic fold change (logFC) relative to WT controls. To further explore the biological implications of these transcriptomic changes, we performed Gene Set Enrichment Analysis (GSEA), which revealed enrichment of GO Biological Process categories such as neural precursor cell proliferation, regulation of neuronal differentiation, and regulation of apoptotic signaling in p75NTR ko mice compared to WT (Supplemental Fig. S4, Supplemental Excel Table S1).

p75NTR is affecting NSC proliferation in a cell non autonomous mechanism

In order to validate whether p75NTR expression specifically in NSCs is majorly controlling the adult hippocampal neurogenesis or if there are other cellular mechanisms derived from p75NTR expression in other cell types, like astrocytes, oligodendrocytes or microglia, we used an animal model, namely p75 fl/fl Nestin Cre, by crossing mice with a specific deletion of p75NTR exonII with the Nestin-Cre mice, in order to delete the receptor only in Nestin positive cells (since Nestin is expressed only in NSCs). We counted again both BrdU⁺Sox2⁺ cells, at the DG of the hippocampus and the analysis showed that the number of proliferating NSCs remained unchanged in p75 fl/fl NestinCre mice compared to the WT (Fig. 3A, C). These results clearly show that p75NTR is affecting adult neurogenesis in a cell non autonomous mechanism.

p75NTR expressed in Nestin⁺ cells does not affect the production of immature neurons

Furthermore, we analyzed if p75NTR specifically expressed in Nestin⁺ cells has an impact in the production of immature neurons. Thus, we counted the number of Dcx⁺ cells in the hippocampal DG of 2 months old p75 fl/fl NestinCre mice. Our results showed that there were no significant differences between the production of immature neurons in WT and p75 fl/fl NestinCre mice (Fig. 3B, D). In agreement with the aforementioned data about the proliferation of NSCs in this mouse model, we suggest that p75NTR expressed specifically in NSCs does not influence their proliferation, neither the production of immature neurons, indicating a cell non autonomous mechanism of action of the receptor in adult neurogenesis.

Increased proliferation rates of NSCs in 2 months old 5xFAD mice

In order to study the proliferation of NSCs under neurodegenerative conditions such as AD, we performed immunofluorescent staining of the coronal sections of hippocampal DG of 2 months old 5xFAD mice. Since there were no significant differences between 5xFAD homozygous vs heterozygous mice (Supplemental Figure S5), we performed our studies with the heterozygous mice (more commonly used in research studies). As it is shown in Fig. 4A and 4B, there is a statistically significant increase in the proliferation rates of NSCs in 2-months old 5xFAD mice when compared to the WT [from 997 ± 28.2 cells (SEM) to 1271.15 ± 80.8 cells (SEM) in 5xFAD mice]. Next, we studied the number of proliferative NSCs in 4 months old 5xFAD mice, and we observed that there is a significant decrease in the number of both BrdU⁺ and Sox2⁺ cells [from 765 ± 38.2 cells (SEM) to 475.5 ± 38.4 cells (SEM) in 5xFAD mice], as expected, since at this age most of the neurodegenerative effects of AD-like pathology have been described to be on their onset in this mouse strain (Fig. 4A, B). Additionally, 6 months old 5xFAD mice showed no significant differences, since in that age the number of proliferative NSCs is very low (Fig. 4A, B). The aforementioned results clearly show that AD background induces hippocampal neurogenesis at the initial stages, a phenomenon that is reversed at older age where AD pathology appears. We hypothesize that the increased number of NSCs observed in the 5xFAD background may represent a compensatory, homeostatic response to the neurodegenerative effects of AD-like pathology, such as the specific result of increased expression of Aβ, which could enhance signaling neurogenic mechanisms (56–59). This response could potentially aim to counteract the neuronal loss typically seen at the onset of the disease, which generally occurs around 4 months of age (39).

2 months old 5xFAD mice present increased number of immature neurons

In order to assess the production of immature neurons in terms of AD, we measured the Dcx⁺ cells in 2 months old 5xFAD mice. By comparing the Dcx⁺ cells in the DG of the hippocampus of WT and 5xFAD mice, we concluded that there is a significant increase between the two groups [from 9410 ± 210 cells (SEM) to 12128.25 ± 847.8 cells (SEM) in 5xFAD mice] (Fig. 4C, D). These results confirm that AD phenotype affects the proliferation of NSCs and it has also a significant impact in the production of new immature neurons, further proposing a general regulatory mechanism of neurogenesis upon Aβ changes. Taking into consideration, the number of immature neurons in 4 months old 5xFAD mice, we observed a significant decrease in the number of Dcx⁺ cells [from 6469.6 ± 310.2 cells (SEM) to 4511.2 ± 180.6 cells (SEM) in 5xFAD mice], as it was expected due to the progress of the neurodegenerative effects of AD (Fig. 4C, D). As it was previously shown in WT mice, the 6 months old 5xFAD mice had no differences, emphasizing on the really low number of immature neurons at this age (Fig. 4C, D).

Deficiency of p75NTR in 2 months old 5xFAD mice regulates the proliferation of NSCs

Based on the above results, we tested the outcome of p75NTR deletion in the 5xFAD mice. We generated double transgenic mice, the 5xFAD/p75NTR ko and by following the same experimental protocols and measuring the number of both BrdU⁺Sox2⁺ cells, we revealed that in 2 months old 5xFAD/p75NTR ko mice there was a significant decrease in the proliferation rates of NSCs when compared to the WT mice, almost at the same levels as in p75NTR ko mice [from 997 ± 28.2 cells (SEM) to 702 ± 40.5 cells (SEM) in 5xFAD/p75NTR ko mice] (Fig. 5A, B). This novel result confirms the crucial role of p75NTR for the proliferation of NSCs, even in the AD background. Furthermore, it is of special notice that this p75NTR-mediated inhibition of NSC proliferation counteracts the 5xFAD genotype, where an elevated NSC proliferation was observed.

Considering the results derived by the 4 months old mice, we observed for once more, a decreased number of proliferative NSCs in the 5xFAD/p75NTR ko mice, showing again the necessity of p75NTR expression [from 765 ± 38.2 cells (SEM) to 176 ± 17.7 cells (SEM) in 5xFAD/p75NTR ko mice] (Fig. 5A, B). Moreover, if we compare the number of proliferative NSCs in the 5xFAD and 5xFAD/p75NTR ko mice, of both ages 2- and 4- months old, we can conclude that the expression of p75NTR is necessary for the proliferation of NSCs under AD both during the onset as well as the progression of the disease (Fig. 5A, B).

p75NTR deficiency in 2 months old 5xFAD mice does not affect the production of immature neurons

Having the above in mind, we analyzed the number of Dcx⁺ cells upon p75NTR deletion in 2 months old 5xFAD mice. The number of Dcx⁺ cells in the DG of the hippocampus of 5xFAD/p75NTR ko mice was reduced compared to p75NTR ko and the 5xFAD mice, and was almost the same as this of the WT mice of the same age (Fig. 5C, D). So, p75NTR deletion is sufficient to abolish the increase in NSC proliferation rates of 5xFAD and also to affect the production of immature neurons and decrease the number of Dcx⁺ cells, compared to p75NTR ko and 5xFAD mice [from 12128.25 ± 847.8 cells (SEM) in 5xFAD mice to 9448.25 ± 243.2 cells (SEM) in 5xFAD/p75NTR ko mice] (Fig. 5C, D).

Comparing the number of Dcx⁺ cells, in 4 months old mice, we observed that although there is a decreased number of immature neurons in the 5xFAD/p75NTR ko mice, this number is not statistically different from that one of the 5xFAD model (Fig. 5C, D). Taking into consideration the significantly reduced number of Dcx⁺ cells at the age of 4 months old, we assume that any potential effects of receptor’s deletion are minimized.

Gene Set Enrichment Analysis revealed genes implicated in p75NTR-dependent effects under AD

To quantitatively evaluate the gene networks associated with the role of p75NTR in AD, we performed RNA sequencing on hippocampal tissue obtained from 5xFAD and 5xFAD/p75NTR ko mice. This analysis identified five significantly upregulated and one downregulated gene, as illustrated in the volcano plot (Supplemental Fig. S6).

Among the upregulated genes, Wdfy1, which interacts with TLR4, is known to promote neurogenesis and facilitate the recruitment of TLR3 and TLR4 signaling adaptors that mediate neural stem cell differentiation and the production of type I interferons and inflammatory cytokines (60). Thbs4, another upregulated gene, is implicated in the migration of newly formed neurons from the rostral migratory stream (RMS) to the olfactory bulb (61). In contrast, the downregulated gene Hes5 plays a critical role in maintaining NSCs, regulating neuronal differentiation, and controlling the timing of the transition between neurogenesis and gliogenesis during mammalian neocortical development (62). To further investigate the functional relevance of p75NTR in the context of AD, we conducted GSEA which revealed that pathways related to neurogenesis, cellular differentiation, and Wnt signaling were enriched in 5xFAD/p75NTR ko samples, whereas pathways associated with cell death, inflammation, DNA damage, stress responses, and regulation of lipid biosynthesis were predominantly enriched in 5xFAD samples (Supplemental Fig. S6). Genes are detailed in Supplemental Excel Table S2.

p75NTR expression in hiPSCs-derived NSCs

Although the use of humanized mouse models as tools for studying human diseases is still meaningful, the translational outcome of any research work demands testing in human tissue or cells. To fulfil this approach, we have explored the p75NTR-dependent effects on neurogenesis using human iPSCs-derived NSCs. This methodology allows also the validation of mouse results, and provides a novel platform for drug screening of new compounds with neuroprotective and/or neurogenic effects against AD. We have generated NSCs from two different iPSC lines, derived from healthy individuals (named as 841, 856). To study the role of p75NTR in human NSCs, we firstly detected its expression in NSC lysates with Western Blot analysis. Apart from p75NTR, NSCs were found to express the p75NTR intracellular interactors RIP2 and TRAF6. Furthermore, the actual interaction of p75NTR with the aforementioned TRAF6 protein also confirmed with co-IP (Fig. 6A) indicating an active state of p75NTR signaling in these cells.

Inhibition of p75NTR rescues Aβ induced toxicity in human iPSCs – derived NSCs

Following the detection and signaling properties of p75NTR, we were interested in investigating the necessity of p75NTR on NSC survival under healthy and AD relevant conditions. To that end, we blocked the activity of p75NTR by using a p75NTR specific neutralizing antibody (2,5ngr/ml, MC-192) which has been extensively used as a selective pharmacological inhibitor of p75NTR activation. AD pathology was mimicked by treating the cells with Aβ peptides (specifically the Aβ1–42 oligomers) that are known to have a toxic effect on cells. The results of cell death measurement using the Celltox assay, provide clear evidence that p75NTR negatively influences human NSC survival after treatment with Aβ peptides indicating a regulatory role of p75NTR in human NSC pathology of AD (Fig. 6B, C).

Inhibition of p75NTR has no effect in proliferation of human NSCs

In continuation of the p75NTR-mediated cell survival effects, we also investigated the effect of p75NTR inhibition on NSC proliferation under healthy conditions. BrdU assay in NSCs, revealed no alteration in the proliferation rate of the cells when p75NTR is inhibited, suggesting that p75NTR is not actively involved at least in human NSC proliferation (Supplemental Figure S7). This finding is in agreement with our results in mice studies, since it proves the cell non autonomous effects of this receptor to NSC proliferation.

The consistent failure of amyloid and tau targeting therapies in AD (1, 2, 5) underscores the critical need to reveal and target pathogenic events, such as the impaired adult hippocampal neurogenesis (63, 64). The p75 neurotrophin receptor is of particular interest due to its complex role and its regulation under AD (65, 66), but its function in regulating adult neurogenesis under neurodegenerative diseases is minimally explored.

In the present study, we decipher the interplay between p75NTR, AD and adult hippocampal neurogenesis. Although p75NTR is classically associated with induction of apoptosis, our data reveal that it is essential for maintaining NSC proliferation and the survival of newborn neurons under physiological conditions. p75NTR deletion severely reduced proliferation, disrupted neuronal maturation by increasing immature neurons while decreasing mature neurons, and elevated cell death. This phenotype suggests that p75NTR facilitates the cell cycle exit and proper maturation of newborn neurons (47, 48, 67), and its loss disrupts this delicate balance, exerting cell-specific actions and ultimately impairing neuronal survival.

A pivotal finding was the lack of a neurogenic phenotype in mice with selective p75NTR deletion in Nestin⁺ NSCs, demonstrating that its pro-neurogenic effect is cell non-autonomous. While our Nestin-Cre model provides evidence for this conclusion, we acknowledge that identifying the specific non-NSC populations involved is a key next step. According to literature, p75NTR is known to be expressed by hippocampal astrocytes and oligodendrocytes (68–70) and its expression in these cells is strongly induced following neural injury or disease (71–73). We propose that p75NTR signaling in these glial cells, supports NSC proliferation and maturation. Future studies using cell-type-specific knockout models (e.g., in GFAP-positive astrocytes or other glial cells) are needed to definitively test this model and identify the putative niche factors involved.

Our transcriptomic analysis of p75NTR knockout hippocampi provided a systems-level view of the receptor's influence, revealing significant alterations in gene networks governing neurogenesis, axonal elongation and cell migration. While these profiling data are descriptive, they serve as a crucial hypothesis-generating resource, identifying specific candidate genes and pathways that may underlie the observed phenotypes. For instance, the downregulation of mediators like Fabp7 and Fxr1, which are known to promote proliferation via the MEK/ERK pathway (51), offers a plausible mechanistic basis for the reduced NSC proliferation.

A particularly intriguing finding was the upregulation of the Ngfr transcript, which is actually the deleted gene, in our knockout models. Interestingly, this mouse line still expresses a truncated p75NTR isoform lacking the neurotrophin-binding domain (74, 75). Thus, this upregulation could be explained by a feedback loop of the cellular system to regain p75NTR functions, indicating its importance in homeostasis. This truncated isoform may mimic proteolytically cleaved intracellular domains of p75NTR, which can possess independent signaling capacity (75, 76).

Under AD context, in the 5xFAD model, we observed a transient increase in neurogenesis at 2 months, which we interpret as a compensatory response to initial Aβ pathology. This aligns with evidence that monomeric or low-dose Aβ can promote neurogenesis and neuronal survival (56–59). By 4 months, as Aβ oligomerization and plaque deposition progress (35, 77) this compensatory response fails, leading to the characteristic decrease in neurogenesis, consistent with the established toxic effects of aggregated Aβ oligomers.

Crucially, p75NTR is essential for the early compensatory response to Aβ, as its deletion in 2-month-old 5xFAD/p75NTR ko mice abolished the increase in NSC proliferation. This reveals a protective role where p75NTR acts as an Aβ sensor to maintain neurogenic output (32, 34), contrasting its well-described role in mediating Aβ toxicity at later disease stages (33). However, in 5xFAD/p75NTR ko mice, Aβ cannot act through deleted p75NTR, resulting in loss of neuroprotection. Therefore, p75NTR deletion does not simply create an additive impairment but rather ablates a specific protective pathway, leading to a premature failure of neurogenic compensation. This dual role aligns with the context-dependent nature of p75NTR signaling and positions it as a key molecule linking early pathological cues to regenerative performance. At the age of 4 months, the combined insults of AD pathology and p75NTR deficiency caused a severe neurogenic collapse, exceeding the deficit in 5xFAD mice alone. However, p75NTR's influence on neuronal differentiation was lost at this later stage, indicating that its primary impact on differentiation is restricted to earlier, pre-symptomatic phases of the disease.

All the results from our in vivo experiments are summarized in Table 2.

Table 2
Summary of the *in vivo* results.
Age Markers		WT vs p75NTR ko	WT vs 5xFAD	5xFAD vs 5xFAD/p75NTR ko
2 months old	BrdU/Sox₂	↓	↑	↓
2 months old	Dcx	↑	↑	↓
4 months old	BrdU/Sox₂	↓	↓	↓
4 months old	Dcx	Not changed	↓	Not changed
Age Markers		WT vs p75NTR ko	WT vs 5xFAD	2mo WT vs 6mo WT
6 months old	BrdU/Sox₂	Not changed	Not changed	↓
6 months old	Dcx	Not changed	Not changed	↓

The translational relevance of our findings is strongly supported by our studies in human iPSC-derived NSCs from healthy donors. We confirmed for the first time to our knowledge, that p75NTR signaling is active in human NSCs and that its inhibition exacerbated Aβ-induced toxicity, indicating a regulatory role of p75NTR in NSC pathology of AD. A limitation of this approach is that NSCs from healthy individuals may not fully recapitulate the molecular landscape of the AD brain. To further validate the pathophysiological significance of our findings, future work should utilize iPSCs derived from AD patients or isogenic lines with edited AD-risk genes (e.g., APP, PSEN1) to model more accurately the disease-specific environment.

Given the context-dependent roles of p75NTR revealed by our study, future therapeutic strategies will need to move towards selective modulation of its signaling pathways. The receptor's duality suggests that promoting its pro-survival outputs while attenuating its pro-apoptotic signals could be strongly beneficial.

This aligns with growing interest in developing synthetic neurotrophin mimetics that achieve receptor selectivity, as recently reviewed by Zota et al. (2025) (78). The feasibility of this approach is demonstrated by compounds like BNN27, which targets p75NTR and TrkA and shows efficacy in AD models (39), and more directly by the p75NTR-modulating ligand LM11A-31, which has progressed to clinical trials for Alzheimer's disease (79). Our findings therefore provide a strong rationale for developing p75NTR-modulating therapies for Alzheimer's disease, underscoring the potential of targeting neurogenic decline.

In summary, our research establishes p75NTR as a critical regulator of adult hippocampal neurogenesis and a key mediator of the brain's compensatory response to early AD pathology. We demonstrate that p75NTR functions through a cell non-autonomous mechanism to regulate the NSC proliferation, differentiation and survival. The observation that p75NTR loss exacerbates neurogenic deficits in AD models provides a new framework for understanding neurogenic decline. While p75NTR has dual roles in cell survival and apoptosis, its pharmacological manipulation may offer a novel strategy to restore neurogenesis and mitigate disease progression. Future studies using AD patient-derived stem cells and in vivo modulation of the receptor will be critical to determine the therapeutic feasibility of p75NTR.

Alzheimer’s disease

NGF

Nerve Growth Factor

BDNF

Brain Derived Neurotrophic Factor

NT3/4

Neurotrophin 3/4

p75NTR

p75 Neurotrophin Receptor

BrdU

5-bromo-2′-deoxyuridine

Sox2

SRY-Box Transcription Factor 2

Dcx

doublecortin

NeuN

Neuronal Nuclear marker

Aβ

Amyloid beta

APP

Amyloid precursor protein

PSEN1

presenilin-1

Wild type

Knock out

hiPSCs

human induced Pruripotent stem cells

NSCs

Neural stem cells

Dentate Gyrus

TMD

Transmembrane Domain

Death Domain

gene ontology

DEA

Differential expression analysis

GSEA

Gene Set Enrichment Analysis

DEGs

differentially expressed genes

qRT PCR

quantitative Real Time Polymerase Chain Reaction

Ngfr

Nerve growth factor Receptor

Ethics approval

All procedures were performed under the approval of Veterinary Directorate of Prefecture of Heraklion (Crete) and carried out in compliance with Greek Government guidelines and the guidelines of FORTH ethics committee and were performed in accordance with approved protocols from the Federation of European Laboratory Animal Science Associations (FELASA) and Use of Laboratory animals [License number: EL91-BIOexp-02), Approval Code: 360667, Approval Date: 29/11/2021 (active for 3 years)]. All research activities strictly adhered to the EU adopted Directive 2010/63/EU on the protection of animals used for scientific purposes.

Competing interests

The authors declare no competing interests.

Funding

This research was funded by: 1) the Hellenic Foundation for Research and Innovation (H.F.R.I.) under the “1st Call for H.F.R.I. Research Projects to support Faculty members and Researchers and the procurement of high-cost research equipment” (Project Number: 2301, KA10490) to I. Charalampopoulos, and by 2) the European Union (European Social Fund-ESF) through the Operational Programme «Human Resources Development, Education and Lifelong Learning» in the context of the Act “Enhancing Human Resources Research Potential by undertaking a Doctoral Research” Sub-action 2: IKY Scholarship Programme for PhD candidates in the Greek Universities». This work was also carried out within 3) the framework of the Action ‘Flagship Research Projects in challenging interdisciplinary sectors with practical applications in Greek industry’, implemented through the National Recovery and Resilience Plan Greece 2.0 and funded by the European Union – NextGenerationEU (project code: TAEDR-0535850), and 4) within the European Union HORIZON, under the European Innovation Council (EIC)-2022-PATHFINDEROPEN-01 program “SoftReach”, No 101099145.

Author Contribution

M.A.P.: conception and design of the study, acquisition and interpretation of the data, drafting the text, MΑP, KC, MP: in vivo experiments, in vitro experiments, analysis of results, I.C.: conception and design of the study, drafting the manuscript, supervision, funding, E.T., K.M., M.L.: RNA-seq analysis

Acknowledgement

We thank Dr Sebastian Thieme from TU of Dresden for providing us the p75 fl/fl mice (Ngfrtm1a(EUCOMM)Wtsi), Alexandros Tsimpolis (PhD student at the University of Crete) for performing qRT-PCR and Dr Μ. Z. Cader for providing the two hiPSC lines.

Data Availability

The RNA-seq datasets generated and analyzed during the current study are available in the GEO repository GSE296390. All materials are available upon request. Supplementary information is available for this paper.

Anand R, Gill KD, Mahdi AA. Therapeutics of Alzheimer’s disease: Past, present and future. Neuropharmacology. 2014;76:27–50.
Zhang J, Zhang Y, Wang J, Xia Y, Zhang J, Chen L. Recent advances in Alzheimer’s disease: mechanisms, clinical trials and new drug development strategies. Signal Transduct Target Ther. 2024;9(1):211.
Armstrong A. Risk factors for Alzheimer’s disease. Folia Neuropathol. 2019;57(2):87–105.
Armstrong RA. The molecular biology of senile plaques and neurofibrillary tangles in Alzheimer’s disease. Folia Neuropathol. 2009;47(4):289–99.
Kodamullil AT, Zekri F, Sood M, Hengerer B, Canard L, McHale D, et al. Trial watch: Tracing investment in drug development for Alzheimer disease. Nat Rev Drug Discov. 2017;16(12):819.
Zhang J, Zhang Y, Wang J, Xia Y, Zhang J, Chen L. Recent advances in Alzheimer’s disease: mechanisms, clinical trials and new drug development strategies. Signal Transduct Target Ther. 2024;9(1):211.
Abdul Manap AS, Almadodi R, Sultana S, Sebastian MG, Kavani KS, Lyenouq VE et al. Alzheimer’s disease: a review on the current trends of the effective diagnosis and therapeutics. Front Aging Neurosci. 2024;16.
Zhao C. Distinct Morphological Stages of Dentate Granule Neuron Maturation in the Adult Mouse Hippocampus. J Neurosci. 2006;26(1):3–11.
Ming GL, Song H. Adult neurogenesis in the mammalian brain: significant answers and significant questions. Neuron. 2011;70(4):687–702.
Kempermann G. Adult Neurogenesis: An Evolutionary Perspective. Cold Spring Harb Perspect Biol. 2016;8(2):a018986.
Dumitru I, Paterlini M, Zamboni M, Ziegenhain C, Giatrellis S, Saghaleyni R et al. Identification of proliferating neural progenitors in the adult human hippocampus. Science (1979). 2025;389(6755):58–63.
Flor-García M, Terreros-Roncal J, Moreno-Jiménez EP, Ávila J, Rábano A, Llorens-Martín M. Unraveling human adult hippocampal neurogenesis. Nat Protoc. 2020;15(2):668–93.
Salta E, Lazarov O, Fitzsimons CP, Tanzi R, Lucassen PJ, Choi SH. Adult hippocampal neurogenesis in Alzheimer’s disease: A roadmap to clinical relevance. Cell Stem Cell. 2023;30(2):120–36.
Moreno-Jiménez EP, Flor-García M, Terreros-Roncal J, Rábano A, Cafini F, Pallas-Bazarra N, et al. Adult hippocampal neurogenesis is abundant in neurologically healthy subjects and drops sharply in patients with Alzheimer’s disease. Nat Med. 2019;25(4):554–60.
Pramanik S, Sulistio YA, Heese K. Neurotrophin Signaling and Stem Cells-Implications for Neurodegenerative Diseases and Stem Cell Therapy. Mol Neurobiol. 2017;54(9):7401–59.
Chao MV. Neurotrophins and their receptors: A convergence point for many signalling pathways. Nat Rev Neurosci. 2003;4(4):299–309.
Dechant G, Barde YA. The neurotrophin receptor p75NTR: novel functions and implications for diseases of the nervous system. Nat Neurosci. 2002;5(11):1131–6.
Barnabé-Heider F, Miller FD. Endogenously Produced Neurotrophins Regulate Survival and Differentiation of Cortical Progenitors via Distinct Signaling Pathways. J Neurosci. 2003;23(12):5149–60.
DeFreitas MF, McQuillen PS, Shatz CJ. A Novel p75NTR Signaling Pathway Promotes Survival, Not Death, of Immunopurified Neocortical Subplate Neurons. J Neurosci. 2001;21(14):5121–9.
Lewin GR, Carter BD. Neurotrophic factors. Preface Handb Exp Pharmacol. 2014;220:v–vi.
Nykjaer A, Willnow TE. Sortilin: a receptor to regulate neuronal viability and function. Trends Neurosci. 2012;35(4):261–70.
Charalampopoulos I, Vicario A, Pediaditakis I, Gravanis A, Simi A, Ibáñez CF. Genetic Dissection of Neurotrophin Signaling through the p75 Neurotrophin Receptor. Cell Rep. 2012;2(6):1563–70.
Ibáñez CF, Simi A. p75 neurotrophin receptor signaling in nervous system injury and degeneration: paradox and opportunity. Trends Neurosci. 2012;35(7):431–40.
Vilar M, Charalampopoulos I, Kenchappa RS, Simi A, Karaca E, Reversi A, et al. Activation of the p75 Neurotrophin Receptor through Conformational Rearrangement of Disulphide-Linked Receptor Dimers. Neuron. 2009;62(1):72–83.
Tomellini E, Lagadec C, Polakowska R, Le Bourhis X. Role of p75 neurotrophin receptor in stem cell biology: more than just a marker. Cell Mol Life Sci. 2014;71(13):2467–81.
Catts VS, Al-Menhali N, Burne THJ, Colditz MJ, Coulson EJ. The p75 neurotrophin receptor regulates hippocampal neurogenesis and related behaviours. Eur J Neurosci. 2008;28(5):883–92.
Bernabeu RO, Longo FM. The p75 neurotrophin receptor is expressed by adult mouse dentate progenitor cells and regulates neuronal and non-neuronal cell genesis. BMC Neurosci. 2010;11(1):136.
Poser R, Dokter M, von Halbach B, Berger V, Busch SM, Baldus R. M, Impact of a deletion of the full-length and short isoform of p75NTR on cholinergic innervation and the population of postmitotic doublecortin positive cells in the dentate gyrus. Front Neuroanat. 2015;9.
Dokter M, Busch R, Poser R, Vogt MA, von Bohlen V, Gass P, et al. Implications of p75NTR for dentate gyrus morphology and hippocampus-related behavior revisited. Brain Struct Funct. 2015;220(3):1449–62.
Boskovic Z, Alfonsi F, Rumballe BA, Fonseka S, Windels F, Coulson EJ. The Role of p75NTR in Cholinergic Basal Forebrain Structure and Function. J Neurosci. 2014;34(39):13033–8.
Zeng F, Lu JJ, Zhou XF, Wang YJ. Roles of p75NTR in the pathogenesis of Alzheimer’s disease: A novel therapeutic target. Biochem Pharmacol. 2011;82(10):1500–9.
Bengoechea TG, Chen Z, O’Leary DA, Masliah E, Lee KF. p75 reduces β-amyloid-induced sympathetic innervation deficits in an Alzheimer’s disease mouse model. Proceedings of the National Academy of Sciences. 2009;106(19):7870–5.
Saadipour K, Yang M, Lim Y, Georgiou K, Sun Y, Keating D, et al. Amyloid beta _1–42 (Aβ₄₂) up-regulates the expression of sortilin via the p75 ^NTR /RhoA signaling pathway. J Neurochem. 2013;127(2):152–62.
Yao XQ, Jiao SS, Saadipour K, Zeng F, Wang QH, Zhu C, et al. p75NTR ectodomain is a physiological neuroprotective molecule against amyloid-beta toxicity in the brain of Alzheimer’s disease. Mol Psychiatry. 2015;20(11):1301–10.
Oakley H, Cole SL, Logan S, Maus E, Shao P, Craft J, et al. Intraneuronal β-Amyloid Aggregates, Neurodegeneration, and Neuron Loss in Transgenic Mice with Five Familial Alzheimer’s Disease Mutations: Potential Factors in Amyloid Plaque Formation. J Neurosci. 2006;26(40):10129–40.
Lee KF, Li E, Huber LJ, Landis SC, Sharpe AH, Chao MV, et al. Targeted mutation of the gene encoding the low affinity NGF receptor p75 leads to deficits in the peripheral sensory nervous system. Cell. 1992;69(5):737–49.
Papadopoulou MA, Rogdakis T, Charou D, Peteinareli M, Ntarntani K, Gravanis A, et al. Neurotrophin Analog ENT-A044 Activates the p75 Neurotrophin Receptor, Regulating Neuronal Survival in a Cell Context-Dependent Manner. Int J Mol Sci. 2023;24(14):11683.
Reinhardt P, Glatza M, Hemmer K, Tsytsyura Y, Thiel CS, Höing S, et al. Derivation and Expansion Using Only Small Molecules of Human Neural Progenitors for Neurodegenerative Disease Modeling. PLoS ONE. 2013;8(3):e59252.
Kokkali M, Karali K, Thanou E, Papadopoulou MA, Zota I, Tsimpolis A et al. Multimodal beneficial effects of BNN27, a nerve growth factor synthetic mimetic, in the 5xFAD mouse model of Alzheimer’s disease. Mol Psychiatry. 2024.
Li S, Jin M, Koeglsperger T, Shepardson NE, Shankar GM, Selkoe DJ. Soluble Aβ Oligomers Inhibit Long-Term Potentiation through a Mechanism Involving Excessive Activation of Extrasynaptic NR2B-Containing NMDA Receptors. J Neurosci. 2011;31(18):6627–38.
Kim D, Paggi JM, Park C, Bennett C, Salzberg SL. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat Biotechnol. 2019;37(8):907–15.
Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 2009;25(16):2078–9.
Anders S, Pyl PT, Huber W. HTSeq—a Python framework to work with high-throughput sequencing data. Bioinformatics. 2015;31(2):166–9.
Chen Y, Chen L, Lun ATL, Baldoni PL, Smyth GK. edgeR v4: powerful differential analysis of sequencing data with expanded functionality and improved support for small counts and larger datasets. Nucleic Acids Res. 2025;53(2).
Zhou Y, Zhou B, Pache L, Chang M, Khodabakhshi AH, Tanaseichuk O, et al. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat Commun. 2019;10(1):1523.
Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proceedings of the National Academy of Sciences. 2005;102(43):15545–50.
Vilar M, Murillo-Carretero M, Mira H, Magnusson K, Besset V, Ibáñez CF. Bex1, a novel interactor of the p75 neurotrophin receptor, links neurotrophin signaling to the cell cycle. EMBO J. 2006;25(6):1219–30.
Underwood CK, Coulson EJ. The p75 neurotrophin receptor. Int J Biochem Cell Biol. 2008;40(9):1664–8.
Nagpal N, Sharma S, Maji S, Durante G, Ferracin M, Thakur JK, et al. Essential role of MED1 in the transcriptional regulation of ER-dependent oncogenic miRNAs in breast cancer. Sci Rep. 2018;8(1):11805.
Li X, Wu L, Corsa CAS, Kunkel S, Dou Y. Two Mammalian MOF Complexes Regulate Transcription Activation by Distinct Mechanisms. Mol Cell. 2009;36(2):290–301.
Ma R, Wang L, Yuan F, Wang S, Liu Y, Fan T, et al. FABP7 promotes cell proliferation and survival in colon cancer through MEK/ERK signaling pathway. Biomed Pharmacother. 2018;108:119–29.
Patzlaff NE, Nemec KM, Malone SG, Li Y, Zhao X. Fragile X related protein 1 (FXR1P) regulates proliferation of adult neural stem cells. Hum Mol Genet. 2017;26(7):1340–52.
Delgado-Esteban M, García-Higuera I, Maestre C, Moreno S, Almeida A. APC/C-Cdh1 coordinates neurogenesis and cortical size during development. Nat Commun. 2013;4(1):2879.
Ly PT, Wang H. Fzr/Cdh1 Promotes the Differentiation of Neural Stem Cell Lineages in Drosophila. Front Cell Dev Biol. 2020;8.
Yu H, Han Y, Cui C, Li G, Zhang B. Loss of SV2A promotes human neural stem cell apoptosis via p53 signaling. Neurosci Lett. 2023;800:137125.
Lopez-Toledano MA. Neurogenic Effect of Aβ-Amyloid Peptide in the Development of Neural Stem Cells. J Neurosci. 2004;24(23):5439–44.
Kim J, Onstead L, Randle S, Price R, Smithson L, Zwizinski C, et al. Aβ40 Inhibits Amyloid Deposition In Vivo. J Neurosci. 2007;27(3):627–33.
Whitson JS, Glabe CG, Shintani E, Abcar A, Cotman CW. β-Amyloid protein promotes neuritic branching in hippocampal cultures. Neurosci Lett. 1990;110(3):319–24.
Wang S, Bolós M, Clark R, Cullen CL, Southam KA, Foa L, et al. Amyloid β precursor protein regulates neuron survival and maturation in the adult mouse brain. Mol Cell Neurosci. 2016;77:21–33.
Hu Y, Zhang Y, Jiang L, Wang S, Lei C, Sun M, et al. WDFY1 mediates TLR3/4 signaling by recruiting TRIF. EMBO Rep. 2015;16(4):447–55.
Girard F, Eichenberger S, Celio MR. Thrombospondin 4 deficiency in mouse impairs neuronal migration in the early postnatal and adult brain. Mol Cell Neurosci. 2014;61:176–86.
Bansod S, Kageyama R, Ohtsuka T. Hes5 regulates the transition timing of neurogenesis and gliogenesis in mammalian neocortical development. Development. 2017;144(17):3156–67.
Hollands C, Tobin MK, Hsu M, Musaraca K, Yu TS, Mishra R, et al. Depletion of adult neurogenesis exacerbates cognitive deficits in Alzheimer’s disease by compromising hippocampal inhibition. Mol Neurodegener. 2017;12(1):64.
Schultz MB, Sinclair DA. When stem cells grow old: phenotypes and mechanisms of stem cell aging. Development. 2016;143(1):3–14.
Malik SC, Sozmen EG, Baeza-Raja B, Le Moan N, Akassoglou K, Schachtrup C. In vivo functions of p75NTR: challenges and opportunities for an emerging therapeutic target. Trends Pharmacol Sci. 2021;42(9):772–88.
Bruno F, Abondio P, Montesanto A, Luiselli D, Bruni AC, Maletta R. The Nerve Growth Factor Receptor (NGFR/p75NTR): A Major Player in Alzheimer’s Disease. Int J Mol Sci. 2023;24(4):3200.
Zanin JP, Abercrombie E, Friedman WJ. Proneurotrophin-3 promotes cell cycle withdrawal of developing cerebellar granule cell progenitors via the p75 neurotrophin receptor. Elife. 2016;5.
Becker K, Cana A, Baumgärtner W, Spitzbarth I. p75 Neurotrophin Receptor: A Double-Edged Sword in Pathology and Regeneration of the Central Nervous System. Vet Pathol. 2018;55(6):786–801.
Cragnolini AB, Friedman WJ. The function of p75NTR in glia. Trends Neurosci. 2008;31(2):99–104.
Zota I, Chanoumidou K, Charalampopoulos I, Gravanis A. Dynamics of myelin deficits in the 5xFAD mouse model for Alzheimer’s disease and the protective role of BDNF. Glia. 2024;72(4):809–27.
Tep C, Lim TH, Ko PO, Getahun S, Ryu JC, Goettl VM, et al. Oral Administration of a Small Molecule Targeted to Block proNGF Binding to p75 Promotes Myelin Sparing and Functional Recovery after Spinal Cord Injury. J Neurosci. 2013;33(2):397–410.
Oderfeld-Nowak B, OrzyŁowska-ŚLiwińska O, SoŁtys Z, Zaremba M, Januszewski S, Janeczko K, et al. Concomitant up-regulation of astroglial high and low affinity nerve growth factor receptors in the CA1 hippocampal area following global transient cerebral ischemia in rat☆. Neuroscience. 2003;120(1):31–40.
Qin X, Wang J, Chen S, Liu G, Wu C, Lv Q, et al. Astrocytic p75^NTR expression provoked by ischemic stroke exacerbates the blood–brain barrier disruption. Glia. 2022;70(5):892–912.
von Schack D, Casademunt E, Schweigreiter R, Meyer M, Bibel M, Dechant G. Complete ablation of the neurotrophin receptor p75NTR causes defects both in the nervous and the vascular system. Nat Neurosci. 2001;4(10):977–8.
Paul CE. A Pro-Apoptotic Fragment of the p75 Neurotrophin Receptor Is Expressed in p75NTRExonIV Null Mice. J Neurosci. 2004;24(8):1917–23.
Murray SS. A Novel p75 Neurotrophin Receptor-Related Protein, NRH2, Regulates Nerve Growth Factor Binding to the TrkA Receptor. J Neurosci. 2004;24(11):2742–9.
Ziegler-Waldkirch S, d′Errico P, Sauer J, Erny D, Savanthrapadian S, Loreth D, et al. Seed‐induced Aβ deposition is modulated by microglia under environmental enrichment in a mouse model of Alzheimer’s disease. EMBO J. 2018;37(2):167–82.
Zota I, Calogeropoulou T, Chanoumidou K, Charalampopoulos I, Gravanis A. Synthetic microneurotrophins: Neurotrophin receptors for therapeutics of neurodegenerative diseases. Br J Pharmacol. 2025.
Shanks HRC, Chen K, Reiman EM, Blennow K, Cummings JL, Massa SM, et al. p75 neurotrophin receptor modulation in mild to moderate Alzheimer disease: a randomized, placebo-controlled phase 2a trial. Nat Med. 2024;30(6):1761–70.

No competing interests reported.

Download PDF

Editorial decision: Revision requested
24 Nov, 2025
Reviews received at journal
04 Nov, 2025
Reviewers agreed at journal
24 Oct, 2025
Reviewers invited by journal
23 Oct, 2025
Editor assigned by journal
08 Oct, 2025
Submission checks completed at journal
08 Oct, 2025
First submitted to journal
06 Oct, 2025

You are reading this latest preprint version

p75 Neurotrophin Receptor Shapes the Dynamics of Adult Hippocampal Neurogenesis in Alzheimer's Disease

Status:

Version 1

Abstract

Figures

Background

Methods

Mice

BrdU labelling

Tissue processing

Immunohistochemistry

Cell counts and quantification

Generation and Culture of Human Neural Stem Cells (hNSCs)

Immunoprecipitation and Immunoblotting

Preparation of Aβ Oligomers

Cell Tox Assay

Isolation of RNA & Sequencing

Differential Expression and GO enrichment analysis

Reverse Transcriptase PCR & Quantitative PCR

Statistical Analysis

Results

p75NTR is a key regulator of NSC proliferation

Impairment of neuronal maturation in p75NTR deficient mice

Reduction of neuronal maturation in the p75NTR ko mice

Genes differential expression analysis confirmed the neurogenic capacity of p75NTR

p75NTR is affecting NSC proliferation in a cell non autonomous mechanism

p75NTR expressed in Nestin+ cells does not affect the production of immature neurons

Increased proliferation rates of NSCs in 2 months old 5xFAD mice

Deficiency of p75NTR in 2 months old 5xFAD mice regulates the proliferation of NSCs

Gene Set Enrichment Analysis revealed genes implicated in p75NTR-dependent effects under AD

p75NTR expression in hiPSCs-derived NSCs

Inhibition of p75NTR rescues Aβ induced toxicity in human iPSCs – derived NSCs

Inhibition of p75NTR has no effect in proliferation of human NSCs

Discussion

Conclusions

Abbreviations

Declarations

Funding

Author Contribution

Acknowledgement

Data Availability

References

Additional Declarations

Supplementary Files

Status:

Version 1

p75NTR expressed in Nestin⁺ cells does not affect the production of immature neurons