Salidroside alleviates fluoride induced pyroptosis and developmental neurotoxicity through P2X7R/NF-κB/NLRP3 pathway

doi:10.21203/rs.3.rs-7375611/v1

Download PDF

Research Article

Salidroside alleviates fluoride induced pyroptosis and developmental neurotoxicity through P2X7R/NF-κB/NLRP3 pathway

https://doi.org/10.21203/rs.3.rs-7375611/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 20 Nov, 2025

Read the published version in Biological Trace Element Research →

You are reading this latest preprint version

Fluoride can cause damage to neurons, but the specific mechanisms remain unclear. Neuronal pyroptosis is associated with cognitive dysfunction, but previous studies mainly focused on hippocampal impairments. This study aimed to whether the P2X7R/NF-κB/NLRP3 pathway would trigger pyroptosis in striatal neurons, thereby mediating neurotoxicity of fluoride, and to evaluate the therapeutic potential of salidroside (Sal). Therefore, an in vivo model of the second-generation (F2) SD rats and an in vitro model of NG108-15 cells exposed to fluoride with sal intervention were established. The radial arm maze (RAM) was used to measure neurobehavioral changes. Hematoxylin-Eosin (HE) and transmission electron microscopy (TEM) were used to observe histopathological and ultrastructural changes in the striatum of F2 rats. Cell viability and the expressions of pyroptosis-related proteins were measured using biochemical methods. HE staining demonstrated striatal neuronal degeneration in fluoride-exposed groups, the RAM test indicated neurobehavioral defects and TEM identified ultrastructural neuronal damage. Fluoride activated the P2X7R/NF-κB/NLRP3 pathway, promoting pyroptosis and impairing the memory ability in F2 rats. Mechanistically, Sal mitigated fluoride-induced neuronal loss by blocking P2X7R/NF-κB/NLRP3 signaling and pyroptotic cell death. In summary, these findings suggest the P2X7R/NF-κB/NLRP3 axis mediates fluoride-induced striatal pyroptosis and neurotoxicity, positioning salidroside as a promising therapeutic candidate.

Fluoride

Striatum

Pyroptosis

P2X7R/NF-κB/NLRP3 pathway

Salidroside

Fluoride exposure induces striatal neuronal pyroptosis and neurobehavioral deficits in offspring rats.
Fluoride-induced neuronal pyroptosis is correlated with P2X7R/NF-κB/NLRP3 pathway.
Salidroside mitigates fluoride-induced neuronal pyroptosis by inhibiting the P2X7R/NF-κB/NLRP3 pathway.

Fluorine has highly reactive chemical properties and usually exists in the form of compounds, with a limited safety threshold. Humans exposed to fluoride mainly through drinking water, tea, fluoride-containing dentifrices foods and air polluted by coal-burning or industrial pollution associated with mining and smelting metals including aluminum, cosmetic formulations, and exposure to industrial pollutants in the workplace or living environment [1, 2]. While moderate fluoride prevents dental caries, overexposure causes multi-organ cytotoxicity, such as harming bone, neural, and reproductive health [3, 4]. Although water defluorination and measures for improving stoves reduced endemic fluorosis, brick tea and industrial pollution sustain fluoride health risks in China [2, 5]. In addition, both excessive and insufficient fluoride intake have been linked to neurostructural changes and cognitive impairment in animal and human studies [6, 7]. Thus, continued research efforts remain critical to unravel the molecular mechanisms underlying the neurotoxic effects of fluoride, which is beneficial for providing a basis for the formulation of prevention or intervention measures.

As a key inflammatory cell death mechanism linked to neurodegeneration, pyroptosis involves cell swelling, DNA fragmentation, and membrane rupture, releasing inflammatory factors that damage neurons [8, 9]. Pathological factors trigger Nod like receptor family pyridine domain containing 3 (NLRP3) inflammasome formation (from NLRP3, apoptosis associated speckle like protein containing CARD (ASC), and the precursor substance of cysteine protease-1 (caspase-1)), activating Caspase-1. Activated Caspase-1 drives pyroptosis by: (1) cleaving Gasdermin-D (GSDMD) to form membrane pores causing osmotic lysis, and (2) cleaving pro-inflammin-1 β (pro-IL-1β) and pro-IL-18 into mature cytokines released via GSDMD pores, amplifying inflammation. Then, these inflammatory factors were released outside the cells, intensifying the inflammatory response and further inducing pyroptosis. Pyroptosis leads to gliosis and neuronal damage in the cerebral cortex, hippocampus, and striatum, thereby mediating cognitive impairment in various neurodegenerative diseases (NDs) [10–14]. Crucially, the striatum is a key brain region governing motor control, reward processing, and cognitive functions, and it fundamentally relies on the health of its neurons for maintaining overall neural integrity. Notably, fluoride exposure has been shown to activate pyroptotic pathways in BV2 microglia [15], while sodium fluoride (NaF)-induced pyroptosis in hipocampi impairs neurodevelopment and offspring learning and memory of SD rats [16]. The above research indicates that the pyroptosis of striatal neurons may be related to the learning and memory impairment caused by NaF, and the precise mechanism deserves further investigation.

The purinergic ligand-gated ion channel 7 receptor (P2X7R), highly expressed in the striatum and elevated in Huntington’s disease (HD), modulates neurodegeneration by upregulating inflammatory cytokines and neurotransmitters [17–19]. Cellular stressors activate nuclear factor kappa B (NF-κB), triggering pro-inflammatory gene transcription; NF-κB overexpression is implicated in Parkinson's disease. [20–22]. The NLRP3 inflammasome complex activates pyroptosis and neuroinflammation, contributing to Alzheimer's disease [9, 23]. P2X7R acts as an inflammation switch, activating NF-κB to promote NLRP3 assembly [24–27].When the body is infected or injured, the damaged cells release a large amount of ATP, activating P2X7R, which triggers NF-κB signaling and NLRP3 formation, thereby activating the effector protein Caspase-1. Activated Caspase-1 cleaves GSDMD, activate pyroptosis-related proteins, triggering an inflammatory response, increasing IL-1β/IL-18 release, that leads to cell pyroptosis[12, 28–33]. Research demonstrates that fluoride exposure significantly elevates NF-κB and IL-1β levels in the brain tissue of rats, thereby causing neurotoxicity [34]. Furthermore, fluoride activates the NLRP3 inflammasome cascade reaction, triggering pyroptotic cell death and impairing learning and memory retention abilities of the offspring generations [16]. These findings further underscore the pivotal role of the striatum in fluoride-induced neurotoxicity. Specifically, fluoride disrupts critical signaling pathways within the striatum, triggering pathological cascade that ultimately culminates in neural impairment, positioning the striatum as both a key mediator and primary target. While this pathway mediates fluoride-induced neurotoxicity, the exact mechanism requires further study.

Salidroside (Sal), chemically identified as 2-(4-hydroxyphenethyl)ethyl-β-D-glucopyranoside, is a bioactive constituent derived from Rhodiola rosea with demonstrated anti-inflammatory, and neuroprotective effects, suggesting its therapeutic potential for neuronal injury [35–40]. Studies have indicated Sal can enhance neurotrophic factors to promote nerve regeneration [41], while also mitigating cognitive decline by reducing neuroinflammation in AD models [35]. Notably, Sal inhibits the P2X7R/NF-κB/NLRP3 regulatory axis, thereby reducing pyroptosis and improving neurological function in brain injury models [35]. Collectively, these findings indicate that the neuroprotective effects of Sal are mainly achieved through this pathway, underscoring the need for further mechanism studies to fully delineate its therapeutic potential against fluoride-induced neurotoxicity.

To elucidate the role of pyroptosis in developmental neurotoxicity induced by fluoride, the present study employed both in vitro NG108-15 cell cultures and in vivo second-generation (F2) Sprague-Dawley (SD) rat model of fluoride exposure. Additionally, we explored the neuroprotective role of Sal intervention in mitigating fluoride-induced neurotoxicity, thereby providing a theoretical and experimental foundation for developing therapies to alleviate memory deficits induced by fluoride.

Cell culture and treatment

NG108-15 cells (ATCC Cell Bank, Shanghai, China). All cell experimental procedures described herein follow established protocols routinely employed in our research facility, with comprehensive methodological descriptions available in previous reports [42].

Ultrapure water was used to dissolve the sodium fluoride (NaF) (> 99% purity, Sigma-Aldrich, USA) and Sal (Guangzhou KKL Med Co., Ltd.) followed by dilution in DMEM medium to the target concentrations prior to experimental treatment. Based on prior IC₅₀ data (80 mg/L NaF) [2], NG108-15 cells at 70–80% confluency, were treated with NaF at 0, 20 (1/4 IC₅₀), 40 (1/2 IC₅₀), and 80 mg/L (IC₅₀) for 24 hours. To assess the impact of P2X7R/NF-κB/NLRP3 signaling on fluoride-induced neurotoxicity, Sal was administered in vitro. Dose-response optimization was performed via the Cell Counting Kit-8 (CCK-8, MCE Company, USA) assay to determine the most biologically relevant Sal concentration. To minimize variability and confirm experimental validity, each assay was conducted at least three independent times.

To determine the non-cytotoxic concentration range of Sal, NG108-15 cells were treated with escalating doses of Sal (control, 6.25, 12.5, 25, 50, and 100 µmol/L) for 24 h. The CCK-8 assay results suggested that 6.25, 12.5, 25, 50, and 100 µmol/L Sal treatments induced no cytotoxicity in NG108-15 cells. Therefore, based on the research results of others, a treatment concentration of 50 µmol/L was selected for intervention [35] (Fig. 4A). To evaluate Sal’s protective effect, cells were first exposed to a toxin for 24 hours; the medium was then replaced, with the treatment group receiving fresh medium containing 50 µmol/L Sal and control groups receiving Sal-free medium. After a further 24-hour incubation, cells were harvested for analysis (Fig. 4B).

Animals and treatments

We bought 16 pregnant SD rats from the Guizhou Laboratory Animal Engineering Technology Center (Certificate No SCXK 2023-0002 in Guizhou, Grade SPF). All rats were housed in plastic cages within an animal facility. Animals were housed under environmental conditions: temperature 22 ± 2°C, relative humidity 65 ± 5%, and a 12-hour light/12-hour dark photo period (light intensity: 278 lux). The animal care guidelines approved by the Ethics Committee of Guizhou Medical University (No. 2303017) to conduct animal experimental procedures.

The exposure doses were determined based on the acute oral toxicity (LD₅₀ = 147.5 mg/kg) of NaF in rats. Sub-lethal doses corresponding to 1/20 LD₅₀ (7.375 mg/kg), 1/10 LD₅₀ (14.75 mg/kg), and 1/5 LD₅₀ (29.5 mg/kg) were chosen to evaluate chronic effects. This dose aligns with previous research, which demonstrated dose-dependent neurotoxicity in Wistar rats exposed to fluoride ion concentrations of 25, 50, and 100 mg/L (equivalent to 55, 110, and 221 mg/L NaF, based on molecular mass ratio of NaF to F⁻) [43]. To further investigate the mechanisms of fluoride-induced neurotoxicity, rats in current study were assigned to four treatment groups: control, low-dose sodium fluoride (60 mg/L NaF), medium-dose (120 mg/L NaF), and high-dose (240 mg/L NaF).

The exposure method involved free drinking water administration across 2 generations. Sixteen pregnant SD rats were continuously exposed from parental gestation until postnatal day 21 (PND21) of their first generation (F1) offspring. From each group, 8 F1 rats (1:1 male-female ratio) were then selected by body weight and maintained on the same exposure regimen until sexual maturity (~ 90 days). Subsequently, 6 F1 rats per group (2 males:1 female) were co-housed for mating and continued exposure until their F2 offspring reached PND21. Finally, 8 F2 rats per group (1:1 male-female ratio) were then selected and exposed until PND 90 (Fig. 2A).

At the end of treatment, urine, serum and brain were collected for biochemical analysis. Following euthanasia, brain tissue was rapidly extracted on ice, rinsed in chilled saline, and dissected to isolate the striatum. For this, the cerebral cortex was gently retracted bilaterally, and the striatal region excised. The cortex of the brain was divided for further multiple analyses.

radial arm maze (RAM) test

Spatial learning and memory in F2 rats were assessed using RAM (XR-XB102, Shanghai Xinruan). Adapt the animals to the experimental environment for one week. Weigh the animals and fast them for 24 hours. The maze consisted of eight arms and a connected central platform. Among these eight arms, arms 1, 2, 4, and 5 were designated as baited arms, while the remaining arms 3, 6, 7 and 8 were termed unbaited arms. Each arm was distinguished by a piece of paper featuring a different geometric shape, pasted at the end of the arm. During the training phase, food pellets were scattered throughout the entire maze on the first day for a 5-minute animal exploration period. On subsequent days, food was only placed within the baited arms. During the final seven days of the treatment schedule, memory parameters were recorded during the 5-minute exploration sessions. These parameters included the time taken to consume all four baits (TTB), working memory errors (WME), and reference memory errors (RME). WME were calculated as the total number of re-entries into arms where the bait had already been consumed. Entries into arms that were never baited were counted as RME.

Measurements of fluoride concentrations

Fluoride concentrations in urine, brain tissue, and serum were determined using ion-selective electrode analysis in accordance with following standardized protocols. Measurement of urinary fluoride adhered to the Chinese national standard WS/T 89-2015: a standard curve (0.1–10.0 mg/L NaF) was prepared, diluted with total ion strength adjustment buffer (TISAB), and analyzed using a fluoride ion electrode, with a detection limit of 0.1 mg/L [44]. Brain tissue (0.2 g per sample) was ashed in a muffle furnace, dissolved in HCl, neutralized with NaOH, mixed with TISAB, and fluoride levels were calculated via electrode readings against a standard curve. Serum fluoride was determined following WS/T 212–2001: blood samples were centrifuged at 3000 rpm for 10 min, and the supernatant was mixed with TISAB prior to electrode measurement. Double-deionized water was used as the reference matrix. Sample analyses included technical replicates, and data represent averaged values.

Transmission electron microscopy (TEM) examination

For TEM analysis of striatal tissue, striatal tissue was dissected and sectioned into 1 mm³ blocks, immediately fixed in 2.5% glutaraldehyde and 2% paraformaldehyde at 4°C for 4 h, and rinsed three times with phosphate-buffered saline (PBS). Next, post-fix in 1% osmium tetroxide at room temperature for 2 h, protected from light, and rinse again three times with PBS. Dehydrate the samples through a graded ethanol series, then transition to 100% acetone. Subsequently, ultrathin sections (70 nm in thickness) were prepared using an ultramicrotome and mounted onto formvar-coated copper grids. Following sectioning, grids underwent staining with 4% uranyl acetate for 15–30 minutes and 0.5% lead citrate for 3–15 minutes. Striatal ultrastructure was then examined using a transmission electron microscope (Japan, hitachi, HT7800).

Histopathological examination

Striatal tissues from F2 SD rats were fixed for HE staining through 24-hour fixation in 4% paraformaldehyde, trimming, sequential dehydration (70%, 95%, 100% ethanol; xylene), and final paraffin encapsulation. Sections (5–7 µm thick) were cut using a microtome, floated on warm water (40°C), mounted on slides, and dried. After differentiation and bluing, sections were counterstained with eosin for 6 min, dehydrated, cleared in xylene, and mounted with neutral gum. Histopathological alterations were examined using a Nikon Eclipse E100 upright optical microscope (Nikon Corporation, Japan)

Western blot analysis

All Western blot procedures described herein follow established protocols routinely employed in our research facility, with comprehensive methodological descriptions available in previous reports [42]. The antibodies used were as follows: NLRP3 (1:2000, Proteintech Group, Inc., Chicago, IL, USA), ASC (1:2000, Proteintech Group, Inc., Chicago, IL, USA.), Caspase-1 (1:2000, Biogot technology, co, Ltd.), GSDMD (1:2000, Baijia Biotechnology Co., Ltd), GSDMD-N (1:2000, Baijia Biotechnology Co., Ltd), IL-1β (1:1000, Baijia Biotechnology Co., Ltd), IL-18 (1:1000, ABclonal Biotechnology Co., Ltd.), P2X7R (1:2000, Biogot technology, co, Ltd. Biogot technology, co, Ltd. MA, USA), NF-κB (1:2000, Huabio Biotechnology Co., Ltd), and β-actin (1:5000, Zen-Bioscience Co., Ltd.).

The gray values were determined using ImageJ 1.53. This software is a widely - used and reliable tool for analyzing digital images.

Reverse transcription-quantitative real-time Polymerase Chain Reaction (RT-qPCR)

The RT-qPCR utilized in this study are standard protocols routinely implemented in our laboratories and have been extensively detailed in prior publications [42]. The primer sequences utilized in this study are summarized in Tables 1 and 2. Sample were normalized to GAPDH. RT-qPCR was performed on a CFX96 real-time PCR detection system (Bio-Rad, USA). The fluorescence threshold in the real - time quantitative PCR experiments was analyzed using the software of the quantitative PCR system (Bio-Rad, Singapore). This software is specifically designed to process and interpret the fluorescence data generated during the PCR amplification process, providing a basis for further quantitative analysis.

Table 1
Sequences of primers used in RT-qPCR for mRNA detections in SD rat cortex
Gene name	Accession number	Sequence( 5'-3' )
NLRP3	NC_086028.1	F	CTTTATCCACTGCCGAGAG
		R	AGCTCATCAAAGCCATCC
ASC	NC_086019.1	F	AACCAGGAGGCAGAGGA
		R	AGACAGGAGTTCCCAGAGC
Caspase-1	NC_086026.1	F	GCCGTGGAGAGAAACAAG
		R	TGAAAAGTGAGCCCCTGA
GSDMD	NC_086025.1	F	TTGAAGGGTGAAGGCAAG
		R	AGCCAATAAGCAGTTGGG
IL-1β	NC_086021.1	F	AGTGTGGATCCCAAACAATACC
		R	AACTGTGCAGACTCAAACTCCA
IL-18	NC_086026.1	F	CGACCGAACAGCCAACGAATC
		R	TCACAGCCAGTCCTCTTACTTCAC
P2X7R	NC_086030.1	F	GCCTGAGCTACATCGCA
		R	GGGGTCCAACACTCTCTTC
NF-κB	NC_086019.1	F	TGCCAAGAGTGATGACGA
		R	CCCATGTCCTGCTCCTT
GAPDH	NC_086022.1	F	GACATGCCGCCTGGAGAAAC
		R	AGCCCAGGATGCCCTTTAGT

Table 2
Sequences of primers used in RT-qPCR for mRNA detections in NG108-15 cells
Gene name	Accession number	Sequence( 5'-3' )
NLRP3	NC_000077.7	F	ATTACCCGCCCGAGAAAGG
		R	CATGAGTGTGGCTAGATCCAAG
ASC	NC_000073.7	F	GACAGTGCAACTGCGAGAAG
		R	CGACTCCAGATAGTAGCTGACAA
Caspase-1	NC_000075.7	F	AATACAACCACTCGTACACGTC
		R	AGCTCCAACCCTCGGAGAAA
GSDMD	NC_000081.7	F	ATGCCATCGGCCTTTGAGAAA
		R	AGGCTGTCCACCGGAATGA
IL-1β	NC_000068.8	F	GAAATGCCACCTTTTGACAGTG
		R	TGGATGCTCTCATCAGGACAG
IL-18	NC_000075.7	F	AGTGCCAGTGAACCCCAGACC
		R	ACAGAGAGGGTCACAGCCAGTC
P2X7R	NC_000071.7	F	GCACCGTCAAGTGGGTCTT
		R	CAGGCTCTTTCCGCTGGTA
NF-κB	NC_000069.7	F	TGCGATTCCGCTATAAATGCG
		R	ACAAGTTCATGTGGATGAGGC
GAPDH	NC_000072.7	F	AGGTCGGTGTGAACGGATTTG
		R	GGGGTCGTTGATGGCAACA

Cell viability assay

Following 24 hours of fluoride treatment, 10 µL of the CCK − 8 (MCE Company, USA) detection solution was carefully added to each well. This step initiated the chemical reaction that would ultimately allow for the determination of cell viability based on the resulting absorbance readings. Sal intervention concentrations were determined by preparing a 10 mmol/L stock solution (10 mg Sal dissolved in 3.33 mL ultrapure water under dark conditions, stored at − 80°C) and diluting it to test doses (6.25–100 µmol/L). Absorbance measurements of the samples were conducted at 450 nm.

Statistical analysis

To ensure the reliability and reproducibility of the findings, each experimental procedure was carried out independently and replicated a minimum of three times. This multiple - repetition approach helps to minimize the impact of random errors and provides a more robust basis for data interpretation. All outcomes are reported as mean ± standard deviation (SD). One-way analysis of variance (ANOVA) served as the primary statistical tool to assess intergroup variations, followed by Least Significant Difference (LSD) tests for pairwise contrasts under conditions of equal variances. For all statistical comparisons in the study, a significance level was predetermined. The chosen significance level was set at α = 0.05.

Fluoride exposure significantly increased fluorine content in the serum, brain, and urine of F2 rats

Fluoride exposure significantly increased fluoride levels in urine, brain, and serum of the F2 rats (P < 0.05) (Table 3), correlating positively with NaF concentrations in drinking water (r = 0.903, 0.974, 0.933, P < 0.05).

Table 3
Fluorine content in the serum, brain, and urine (n = 8, mean ± SD)
Groups	Content in the serum (mg/L)	Content in the brain (µg/g)	Content in the urine (mg/L)
Control group	0.0054 ± 0.0003	7.0650 ± 0.7914	1.8938 ± 0.231
60 mg/L NaF	0.0303 ± 0.0022 ^a	14.2287 ± 1.8601 ^a	11.3637 ± 0.912 ^a
120 mg/L NaF	0.0413 ± 0.0031 ^abb	18.1462 ± 1.9837 ^ab	15.2988 ± 0.263 ^ab
240 mg/L NaF	0.0870 ± 0.0055 ^abc	28.7387 ± 2.1915 ^abc	18.6675 ± 2.009 ^abc
F	1055.74	194.02	270.78
P	< 0.05	< 0.05	< 0.05
^a P < 0.05 compared with control.
^b P < 0.05 compared with 60 mg/L group.
^c P < 0.05 compared with 120 mg/L group

Fluoride induces neurobehavioral deficits associated with pyroptosis and impairments of striatal neurons in F2 rats

Memory functions of fluoride exposure F2 SD rats were examined in terms of selected three behavioral parameters such as TTB, WME, and RME in the RAM test. Figure 1A, 1B shows the fluoride-induced memory impairment on TTB, WME, and RME assessment. Furthermore, multiple post hoc analyses indicated that fluoride-treatment extensively increased (P < 0.01) the TTB, WME, and RME as compared with the control, representing the memory decline by fluoride exposure. HE staining revealed dose-dependent neuronal damage in the striatum: low/medium fluoride groups showed cytoplasmic vacuolization, cell shrinkage, and unclear nuclear boundaries, while the high-dose group exhibited similar but milder degeneration (Fig. 1C). TEM confirmed pyroptosis in fluoride-exposed groups, with features like membrane rupture, “exocytosis” protrusions (red arrows), increased intracellular matrix density, organelle swelling, and abnormal chromatin aggregation (Fig. 1D).

To determine whether fluoride disrupts pyroptosis, we selected representative pyroptosis-related markers, including NLRP3, ASC, Caspase-1, GSDMD, GSDMD-N, IL-1β, IL-18. Fluoride exposure significantly increased mRNA and protein levels of pyroptosis-related markers in the striatal neurons of F2 SD rat compared to control group (P < 0.05) (Fig. 2B-G).

The concordant upregulation of NLRP3 inflammasome components, GSDMD cleavage products, and pro-inflammatory cytokines underscores fluoride-induced activation of the NLRP3 pathway, driving pyroptosis and neuroinflammatory responses. These outcomes collectively implicate chronic fluoride exposure in neuronal dysfunction through inflammatory cell death mechanisms.

Fluoride stimulates P2X7R/NF-κB/NLRP3 regulatory pathway in F2 SD rat striatal neurons

As the P2X7R/NF-κB/NLRP3 regulatory pathway is centrally implicated in pyroptosis regulation, we examined the potential alterations in key pyroptosis-related effectors following NaF exposure to elucidate mechanistic links to neurotoxicity. Fluoride exposure significantly increased mRNA and protein expression levels of the P2X7R/NF-κB/NLRP3 regulatory pathway in the striatum neurons of F2 rat. Compared to control group, both the protein and mRNA levels of P2X7R, NF-κB, and NLRP3 were elevated significantly (P < 0.05) (Fig. 3A-C). These findings suggest fluoride stimulates the P2X7R/NF-κB/NLRP3 regulatory pathway, driving neuroinflammation and pyroptosis in rat striatal neurons.

Sal inhibits fluoride induced pyroptosis and ultrastructure impairment of NG108-15 cells 下面标黄部分即剂量选择及细胞处理, 应该放在方法部分!先染氟24小时, 才进行的治疗。所有内容一定要核对和大论文一致性༁

Compared with the control group, the cell viability in the F groups was significantly decreased (P < 0.05); compared with the F groups, the cell viability in the F + Sal groups significantly recovered. (P < 0.05) (Fig. 4B), indicating Sal’s protective role against fluoride-induced neurotoxicity.

TEM was utilized to evaluate the effect of fluoride on the ultrastructure of NG108-15 cells. Under TEM, control group showed regular shapes, intact membranes, sparse internal material, and normal nuclei. In contrast, high fluoride-exposed cells displayed severe damage: ruptured membranes (red arrows), pyroptosis (inflammatory cell death), leakage of cell contents, swollen organelles, and irregular nuclei. Despite these changes, nuclear membrane remained intact. These findings confirm fluoride induces pyroptosis, marked by structural breakdown and organelle stress (Fig. 4C).

Fluoride exposure significantly increased mRNA and protein levels of pyroptosis-related markers in NG108-15 cells compared to controls (P < 0.05) (Figs. 5A-H). Elevated mRNA expression (Fig. 5C, D, H) and upregulated protein levels (Figs. 5A, B, E, F) of NLRP3, ASC, Caspase-1, GSDMD and its active fragment GSDMD-N, and inflammatory cytokines (IL-1β, IL-18) indicate fluoride activates the NLRP3 pathway, driving neuroinflammation and pyroptosis. These findings suggest chronic fluoride exposure disrupts neuronal integrity via inflammatory cell death.

Sal inhibits pyroptosis by inhibiting the P2X7R/NF-κB/NLRP3 signaling pathway in NG108-15 cells, thereby counteracting fluoride-induced neuronal cell death

Under TEM, control group showed regular shapes, intact membranes, and sparse intracellular material, while Sal-treated cells alone exhibited minor irregularities but no pyroptosis. In contrast, high fluoride-exposed cells displayed severe pyroptosis: ruptured membranes (red arrows), matrix leakage, and organelle swelling. However, combining fluoride with Sal (50 µmol/L) reduced damage, showing only localized membrane protrusions (red arrows) and mild edema, indicating Sal mitigates fluoride-induced pyroptosis (Fig. 4C). These findings align with prior studies where Sal inhibited NLRP3 inflammasome activation, highlighting its neuroprotective role against fluoride neurotoxicity.

Fluoride exposure induced a significant upregulation of P2X7R, NF-κB, and NLRP3 mRNA and protein in NG108-15 cells (P < 0.05) (Fig. 6A-C), paralleling results from animal studies. This convergence of in vitro and in vivo evidence implicates the P2X7R/NF-κB/NLRP3 axis as a conserved mediator of fluoride-induced neuroinflammatory signaling.

Sal co-administration with fluoride significantly diminished the fluoride-driven upregulation of P2X7R, NF-κB, and NLRP3 mRNA and protein compared to the fluoride-alone condition (P < 0.05) (Fig. 6A-C), highlighting its inhibitory action on the P2X7R/NF-κB/NLRP3 inflammatory pathway. These observations align with previous work, reinforcing the notion that Sal attenuates fluoride-induced neurotoxicity through modulation of this pathway.

In this study, to accurately reflect the cumulative effects of fluoride, established a F2 rat model of sustained fluoride exposure, thereby simulating the prolonged and uninterrupted exposure that indigenous populations may experience in regions with elevated natural fluoride levels in groundwater or chronic industrial pollution. This multi-generational approach is essential, as it captures not only the acute but also the compounding developmental effects across generations, providing a more realistic representation of real-world conditions. Consistent with prior studies [45], fluoride bioaccumulation in urine, brain tissue, and serum demonstrated a dose-responsive elevation in this animal model. Fluoride levels across biological matrices correlated strongly with drinking water concentrations, confirming exposure level in F2 SD rats. The neurobehavioral changes were investigated using 8 arms RAM test. The RAM test is sensitive to the long-term neurobehavioral toxicity of developmental exposure. The findings of the present investigation provide compelling evidence that developmental fluoride exposure induces significant, long-lasting impairments in memory function among the F2 rats, highlighting its potential to exert long-term neurodevelopmental toxicity with implications for cognitive health. Previous studies have established that pro-inflammatory systemic environments and neuroinflammation disrupt learning and memory in SD rats by impairing synaptic plasticity and suppressing hippocampal neurogenesis, critical processes for cognitive function [46]. The striatum is equally vulnerable to neuroinflammatory insult, where impaired synaptic plasticity exacerbates both motor deficits and cognitive dysfunction. Characterized by lytic membrane disruption and cytokine-mediated inflammation, pyroptosis amplifies neurotoxic microenvironments through IL-1β and IL-18 secretion. This pathway not only accelerates neuronal loss but also inhibits neurodevelopmental and restorative processes, thereby exacerbating cognitive decline in neuroinflammatory conditions such as AD, Parkinson’s disease (PD), and multiple sclerosis [47, 48]. A key driver of this process is the P2X7R/NF-κB/NLRP3 regulatory pathway, which regulates inflammatory signaling activation of the P2X7R triggers NF-κB-mediated transcription of NLRP3 inflammasome components, leading to inflammasome assembly and Caspase-1 activation. This cascade promotes pyroptosis by cleaving GSDMD to form membrane pores and processing pro-inflammatory cytokines into their active forms, thereby amplifying neuroinflammation, inducing neuronal death, and perpetuating a cycle of tissue damage [28, 29, 31–33]. In this study, our cellular models provide mechanistic evidence that Salidroside (Sal) exerts neuroprotection against fluoride-induced neurotoxicity by targeting the P2X7R/NF-κB/NLRP3 pathway. Sal effectively inhibits P2X7R activation, suppresses downstream NF-κB-mediated NLRP3 inflammasome assembly, and reduces Caspase-1-dependent pyroptotic cell death (evidenced by decreased GSDMD cleavage and IL-1β/IL-18 maturation). The findings, derived from cellular models in this study, provide mechanistic evidence supporting the neuroprotective efficacy of Sal against fluoride-induced neurotoxicity.

This study demonstrates that the F2 rats exposed to chronic fluoride exhibit striatal pathological damage and ultrastructural abnormalities, accompanied by upregulation of cell death-associated proteins, increased inflammatory cytokine secretion, and subsequent neurodegeneration. Similar striatal degeneration is seen in HD, marked by loss of key neurons [49]. Parallel studies show manganese exposure harms striatal neurons, impairing learning/memory, while curcumin treatment reduces such damage [50]. These effects may occur through the P2X7R/NF-κB/NLRP3 regulatory axis, where fluoride likely activates a chain reaction: the P2X7 receptor sparks NF-κB signaling, which boosts the NLRP3 inflammasome, ultimately driving inflammation and neuronal damage.

In current study, TEM analysis revealed that fluoride-exposed neurons showed severe pyroptosis, marked by compromised plasma membrane integrity, extracellular leakage of cytoplasmic contents, and swollen cellular organelles. However, treatment with Sal reduced these effects, partially repairing cell membranes and inhibiting pyroptosis. At the same time, fluoride exposure also increased levels of pyroptosis-related proteins and inflammatory molecules. After Sal treatment, both mRNA and protein expression levels of these key factors decreased. Consistent with these observations, prior studies have demonstrated that aluminum exposure induces neuronal pyroptosis via the NLRP3 regulatory pathway [51–53]. Conversely, fluoride has been shown to activate the same pathway in microglia, thereby promoting neuroinflammatory responses [15]. Prior investigations have demonstrated that Sal administration suppresses NLRP3 inflammasome pathway activation and downregulates associated protein expression, leading to diminished inflammatory cytokine secretion and subsequent attenuation of neuroinflammation and cognitive deficits in mouse models [54]. Sal reduces the protein expression of pyroptosis key factors and alleviates pyroptosis in LPS induced BV2 cells [55]. This is consistent with the present study results, suggesting that fluoride exposure induces pyroptosis in NG108-15 cells, while Sal can alleviate fluoride induced pyroptosis in these cells. However, exactly how Sal blocks fluoride neurotoxicity remains unclear and requires further study to fully understand its protective mechanism. whether by directly targeting NLRP3, reducing oxidative stress, or influencing other pathways.

Previous studies have shown that Sal exerts neuroprotective effects through anti-inflammatory mechanisms and improves cognitive functions, particularly memory, attention processing, and critical thinking abilities. Both in vivo and in vitro studies have verified the therapeutic effects of Sal in alleviating neurological diseases [38, 40]. Research has shown that Sal can significantly suppress neuronal loss in the cerebral cortex and striatum of ischemic induced stroke rats. In the NDs animal model, Sal can upregulate the expression of dopamine transporters in the striatum and alleviate cognitive impairment [56]. Sal has been shown to suppress the release of the pro-inflammatory cytokine IL-1β and attenuate microglial activation, thereby ameliorating spatial learning/memory deficits in a mouse model of PTSD [57]. Other studies have shown that the Sal treatment inhibited excessive inflammatory responses and oxidative stress, and alleviated neuronal damage in mice, thereby improving motor coordination defects and enhancing learning and memory abilities [58]. In the AD model, Sal ameliorates cognitive impairment in rats by inhibiting NLRP3/Caspase-1/GSDMD mediated pyroptosis [35, 59]. Furthermore, P2X7R activation has been shown to trigger NF-κB signaling, induce NLRP3 inflammasome assembly, and propagate neuroinflammatory responses, culminating in pyroptosis, gliosis, and neuronal/cognitive dysfunction in rodents [32]. Dysregulation of the P2X7R/NF-κB/NLRP3 regulatory pathway is further linked to pathological conditions such as vascular dementia and diabetic encephalopathy [30, 60]. Therefore, this study establishes a fluoride exposed NG108-15 cell model with Sal intervention and explores whether Sal can improve fluoride induced pyroptosis by suppressing the P2X7R/NF-κB/NLRP3 regulatory pathway through in vitro experiments.

Research indicates that Sal suppresses the NF-κB pathway in microglial BV2 cells, blocking the activation of the NLRP3 inflammasome and reducing levels of ASC, Caspase-1 and inflammatory cytokines (IL-1β, IL-18) in conditions like cerebral ischemia-reperfusion injury, thereby mitigating cell death [61]. Since NF-κB and NLRP3 are key downstream components of the P2X7R pathway, their activity depends on P2X7R expression levels [24]. In this study, fluoride exposure increased mRNA and protein levels of P2X7R, NF-κB, and NLRP3 in NG108-15 neuronal cells, but Sal treatment reversed these effects, lowering their expression. Supporting this, studies on Sal’s antidepressant-like properties show it inhibits the P2X7R/NF-κB/NLRP3 regulatory pathway in mouse hippocampal tissue and NG108-15 cells, reducing pyroptosis-related proteins and improving neurological function [35]. Collectively, these findings align with the following results in this study that Sal exerts neuroprotective effects against fluoride-induced pyroptosis in NG108-15 cells, mediated through inhibition of the P2X7R/NF-κB/NLRP3 regulatory pathway.

While this study highlights the striatum as a primary site of fluoride-induced pyroptosis, its limitations include reliance on in vitro data and the absence of whole-animal validation for Sal’s protective effects. Future work should use gene knockout and animal models to confirm the central role of the P2X7R/NF-κB/NLRP3 axis in striatal injury and to test Sal’s translational potential.

Fluoride induces striatal neurotoxicity through pyroptosis mediated by the P2X7R/NF-κB/NLRP3 pathway. Notably, Sal was shown to exert neuroprotective effects by inhibiting the P2X7R/NF-κB/NLRP3 inflammatory cascade, which subsequently abrogated pyroptotic signaling. These findings not only elucidate a novel protective mechanism of Sal but also advocate for targeting the P2X7R/NF-κB/NLRP3 regulatory pathway as a viable strategy to treat fluoride-associated neurotoxicity in future preclinical investigations.

CCK-8: Cell Counting Kit-8; Caspase-1, Cysteinyl aspartate specific proteinase 1; SD: standard deviation; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; NF-κB, Nuclear Factor Kappa B; IL-1β, Interleukin 1 beta; NLRs, NOD-like receptors;

Acknowledgements

Funding for this project were provided by National Key R&D Program of China (2022YFC2503002).

Author Contribution

X.C. initiated and supervised this research project. She was responsible for conceiving the research idea, designing the experimental protocols, and contributing to the writing and editing of the manuscript. X. Y. carried out all the experiments and performed the analysis of the experimental data. Subsequently, X. Y. collaborated with T. Z.y .in the process of manuscript composition; they worked together to ensure the logical flow and scientific accuracy of the written content. Meanwhile, T. D. participated in the revision of the manuscript, providing valuable suggestions for improvement. Additionally, Q. X.l., J. H.s., and G. Y.l. were involved in the experimental work and assisted in the establishment of the sodium fluoride - exposed offspring SD rat model. Their contributions were essential for the successful completion of the experimental phase of the study.

Declaration of interests

☒ The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

☐ The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:

Saeed M, Malik RN, Kamal A (2020) Fluorosis and cognitive development among children (6–14 years of age) in the endemic areas of the world: a review and critical analysis. Environ Sci Pollut Res Int 27(3):2566–2579. https://doi.org/10.1007/s11356-019-06938-6
Ting C, Guohui B, Yuan T, Yu G (2022) Research progress on the effects of various macro and trace elements on fluorosis. Chin J Endemiology 41(3):253–258. https://doi.org/10.3760/cma.j.cn231583-20210308-00071
Dall Agnol MA, Battiston C, Tenuta LMA, Cury JA (2022) Fluoride Formed on Enamel by Fluoride Varnish or Gel Application: A Randomized Controlled Clinical Trial. Caries Res 56(1):73–80. https://doi.org/10.1159/000521454
Li X, Yang J, Liang C, Yang W, Zhu Q, Luo H, Liu X, Wang J, Zhang J (2022) Potential Protective Effect of Riboflavin Against Pathological Changes in the Main Organs of Male Mice Induced by Fluoride Exposure. Biol Trace Elem Res 200(3):1262–1273. https://doi.org/10.1007/s12011-021-02746-7
Hui L, Lijun Z, Peng L, Jun Y, Jie H, Junrui P, Dianjun S (2022) Achievement in prevention and control of endemic diseases in China in the past 10 years (2012–2021), challenges in the future and countermeasures. Chin J Endemiology 41(9):689–694. https://doi.org/10.3760/cma.j.cn231583-20220802-00276
Grandjean P (2019) Developmental fluoride neurotoxicity: an updated review. Environ Health 18(1):110. https://doi.org/10.1186/s12940-019-0551-x
Liang C, He Y, Liu Y, Gao Y, Han Y, Li X, Zhao Y, Wang J, Zhang J (2020) Fluoride exposure alters the ultra-structure of sperm flagellum via reducing key protein expressions in testis. Chemosphere 246:125772. https://doi.org/10.1016/j.chemosphere.2019.125772
Lu F, Lan Z, Xin Z, He C, Guo Z, Xia X, Hu T (2020) Emerging insights into molecular mechanisms underlying pyroptosis and functions of inflammasomes in diseases. J Cell Physiol 235(4):3207–3221. https://doi.org/10.1002/jcp.29268
Swanson KV, Deng M, Ting JP (2019) The NLRP3 inflammasome: molecular activation and regulation to therapeutics. Nat Rev Immunol 19(8):477–489. https://doi.org/10.1038/s41577-019-0165-0
Li S, Sun Y, Song M, Song Y, Fang Y, Zhang Q, Li X, Song N, Ding J, Lu M, Hu G (2021) NLRP3/caspase-1/GSDMD-mediated pyroptosis exerts a crucial role in astrocyte pathological injury in mouse model of depression. JCI Insight 6(23). https://doi.org/10.1172/jci.insight.146852
Paldino E, D'Angelo V, Sancesario G, Fusco FR (2020) Pyroptotic cell death in the R6/2 mouse model of Huntington's disease: new insight on the inflammasome. Cell Death Discov 6:69. https://doi.org/10.1038/s41420-020-00293-z
Poh L, Fann DY, Wong P, Lim HM, Foo SL, Kang S, Rajeev V, Selvaraji S, Iyer VR, Parathy N, Khan MB, Hess DC, Jo D, Drummond GR, Sobey CG, Lai MKP, Chen CL, Lim LHK, Arumugam TV (2021) AIM2 inflammasome mediates hallmark neuropathological alterations and cognitive impairment in a mouse model of vascular dementia. Mol Psychiatry 26(8):4544–4560. https://doi.org/10.1038/s41380-020-00971-5
Wang S, Yuan Y, Chen N, Wang H (2019) The mechanisms of NLRP3 inflammasome/pyroptosis activation and their role in Parkinson's disease. Int Immunopharmacol 67:458–464. https://doi.org/10.1016/j.intimp.2018.12.019
Zhao N, Sun C, Zheng M, Liu S, Shi R (2019) Amentoflavone suppresses amyloid beta1-42 neurotoxicity in Alzheimer's disease through the inhibition of pyroptosis. Life Sci 239:117043. https://doi.org/10.1016/j.lfs.2019.117043
Zhang Q, Li T, Shi R, Qi R, Hao X, Ma B (2024) Fluoride promotes the secretion of inflammatory factors in microglia through NLRP3/Caspase-1/GSDMD pathway. Environ Sci Pollut Res Int 31(13):19844–19855. https://doi.org/10.1007/s11356-024-32443-6
Zhang J, Tang Y, Hu Z, Xu W, Ma Y, Xu P, Xing H, Niu Q (2023) The inhibition of TRPML1/TFEB leads to lysosomal biogenesis disorder, contributes to developmental fluoride neurotoxicity. Ecotoxicol Environ Saf 250:114511. https://doi.org/10.1016/j.ecoenv.2023.114511
Andrejew R, Oliveira-Giacomelli A, Ribeiro DE, Glaser T, Arnaud-Sampaio VF, Lameu C, Ulrich H (2020) The P2X7 Receptor: Central Hub of Brain Diseases. Front Mol Neurosci 13:124. https://doi.org/10.3389/fnmol.2020.00124
Glaser T, Andrejew R, Oliveira-Giacomelli A, Ribeiro DE, Bonfim Marques L, Ye Q, Ren W, Semyanov A, Illes P, Tang Y, Ulrich H (2020) Purinergic Receptors in Basal Ganglia Diseases: Shared Molecular Mechanisms between Huntington's and Parkinson's Disease. Neurosci Bull 36(11):1299–1314. https://doi.org/10.1007/s12264-020-00582-8
Olla I, Santos-Galindo M, Elorza A, Lucas JJ (2020) P2X7 Receptor Upregulation in Huntington's Disease Brains. Front Mol Neurosci 13:567430. https://doi.org/10.3389/fnmol.2020.567430
Li Y, Xia Y, Yin S, Wan F, Hu J, Kou L, Sun Y, Wu J, Zhou Q, Huang J, Xiong N, Wang T (2021) Targeting Microglial alpha-Synuclein/TLRs/NF-kappaB/NLRP3 Inflammasome Axis in Parkinson's Disease. Front Immunol 12:719807. https://doi.org/10.3389/fimmu.2021.719807
Mitchell JP, Carmody RJ (2018) NF-kappaB and the Transcriptional Control of Inflammation. Int Rev Cell Mol Biol 335:41–84. https://doi.org/10.1016/bs.ircmb.2017.07.007
Wang Y, Gao X, Tang Y, Yu Y, Sun M, Chen F, Li Y (2022) The Role of NF-kappaB/NLRP3 Inflammasome Signaling Pathway in Attenuating Pyroptosis by Melatonin Upon Spinal Nerve Ligation Models. Neurochem Res 47(2):335–346. https://doi.org/10.1007/s11064-021-03450-7
Mangan MSJ, Olhava EJ, Roush WR, Seidel HM, Glick GD, Latz E (2018) Targeting the NLRP3 inflammasome in inflammatory diseases. Nat Rev Drug Discov 17(8):588–606. https://doi.org/10.1038/nrd.2018.97
Guan F, Jiang W, Bai Y, Hou X, Jiang C, Zhang C, Jacques ML, Liu W, Lei J (2021) Purinergic P2X7 Receptor Mediates the Elimination of Trichinella spiralis by Activating NF-kappaB/NLRP3/IL-1beta Pathway in Macrophages. Infect Immun 89(5). https://doi.org/10.1128/IAI.00683-20
Li Z, Huang Z, Zhang H, Lu J, Tian Y, Wei Y, Yang Y, Bai L (2021) P2X7 Receptor Induces Pyroptotic Inflammation and Cartilage Degradation in Osteoarthritis via NF-kappaB/NLRP3 Crosstalk. Oxid Med Cell Longev 2021:8868361. https://doi.org/10.1155/2021/8868361
Yoshida K, Okamura H, Hiroshima Y, Abe K, Kido J, Shinohara Y, Ozaki K (2017) PKR induces the expression of NLRP3 by regulating the NF-kappaB pathway in Porphyromonas gingivalis-infected osteoblasts. Exp Cell Res 354(1):57–64. https://doi.org/10.1016/j.yexcr.2017.03.028
Zhang Q, Hu F, Guo F, Zhou Q, Xiang H, Shang D (2019) Emodin attenuates adenosine triphosphate–induced pancreatic ductal cell injury in vitro via the inhibition of the P2X7/NLRP3 signaling pathway. Oncol Rep 42(4):1589–1597. https://doi.org/10.3892/or.2019.7270
Ball DP, Taabazuing CY, Griswold AR, Orth EL, Rao SD, Kotliar IB, Vostal LE, Johnson DC, Bachovchin DA (2020) Caspase-1 interdomain linker cleavage is required for pyroptosis. Life Sci Alliance 3(3). https://doi.org/10.26508/lsa.202000664
Kong H, Zhao H, Chen T, Song Y, Cui Y (2022) Targeted P2X7/NLRP3 signaling pathway against inflammation, apoptosis, and pyroptosis of retinal endothelial cells in diabetic retinopathy. Cell Death Dis 13(4):336. https://doi.org/10.1038/s41419-022-04786-w
Poh L, Sim WL, Jo D, Dinh QN, Drummond GR, Sobey CG, Chen CL, Lai MKP, Fann DY, Arumugam TV (2022) The role of inflammasomes in vascular cognitive impairment. Mol Neurodegener 17(1):4. https://doi.org/10.1186/s13024-021-00506-8
Yang Y, Wang H, Kouadir M, Song H, Shi F (2019) Recent advances in the mechanisms of NLRP3 inflammasome activation and its inhibitors. Cell Death Dis 10(2):128. https://doi.org/10.1038/s41419-019-1413-8
Yuan B, Zhou X, You Z, Xu W, Fan J, Chen S, Han Y, Wu Q, Zhang X (2020) Inhibition of AIM2 inflammasome activation alleviates GSDMD-induced pyroptosis in early brain injury after subarachnoid haemorrhage. Cell Death Dis 11(1):76. https://doi.org/10.1038/s41419-020-2248-z
Zhang Z, Gu X, Zhao X, He X, Shi H, Zhang K, Zhang Y, Su Y, Zhu J, Li Z, Li G (2021) NLRP3 ablation enhances tolerance in heat stroke pathology by inhibiting IL-1beta-mediated neuroinflammation. J Neuroinflammation 18(1):128. https://doi.org/10.1186/s12974-021-02179-y
Yildiz MO, Celik H, Caglayan C, Kandemir FM, Gur C, Bayav I, Genc A, Kandemir O (2022) Neuromodulatory effects of hesperidin against sodium fluoride-induced neurotoxicity in rats: Involvement of neuroinflammation, endoplasmic reticulum stress, apoptosis and autophagy. Neurotoxicology 90:197–204. https://doi.org/10.1016/j.neuro.2022.04.002
Chai Y, Cai Y, Fu Y, Wang Y, Zhang Y, Zhang X, Zhu L, Miao M, Yan T (2022) Salidroside Ameliorates Depression by Suppressing NLRP3-Mediated Pyroptosis via P2X7/NF-kappaB/NLRP3 Signaling Pathway. Front Pharmacol 13:812362. https://doi.org/10.3389/fphar.2022.812362
Gao Z, Zhan H, Zong W, Sun M, Linghu L, Wang G, Meng F, Chen M (2023) Salidroside alleviates acetaminophen-induced hepatotoxicity via Sirt1-mediated activation of Akt/Nrf2 pathway and suppression of NF-kappaB/NLRP3 inflammasome axis. Life Sci 327:121793. https://doi.org/10.1016/j.lfs.2023.121793
Jin M, Wang C, Xu Y, Zhang Z, Wu X, Ye R, Zhang Q, Han D (2022) Pharmacological effects of salidroside on central nervous system diseases. Biomed Pharmacother 156:113746. https://doi.org/10.1016/j.biopha.2022.113746
Niu L, Xu M, Liu W, Yu H, Yu S, Li F, Wang T, Sun D, Yao T, Li W, Yang Z, Liu X, Zuo Z (2024) The GLCCI1/STAT3 pathway: a novel pathway involved in diabetic cognitive dysfunction and the therapeutic effect of salidroside. J Mol Histol 55(5):851–861. https://doi.org/10.1007/s10735-024-10236-y
Shen J, Chen S, Li X, Wu L, Mao X, Jiang J, Zhu D (2024) Salidroside Mediated the Nrf2/GPX4 Pathway to Attenuates Ferroptosis in Parkinson's Disease. Neurochem Res 49(5):1291–1305. https://doi.org/10.1007/s11064-024-04116-w
Zhang X, Xie L, Long J, Xie Q, Zheng Y, Liu K, Li X (2021) Salidroside: A review of its recent advances in synthetic pathways and pharmacological properties. Chem Biol Interact 339:109268. https://doi.org/10.1016/j.cbi.2020.109268
Zheng J, Zhang J, Han J, Zhao Z, Lin K (2024) The effect of salidroside in promoting endogenous neural regeneration after cerebral ischemia/reperfusion involves notch signaling pathway and neurotrophic factors. BMC Complement Med Ther 24(1):293. https://doi.org/10.1186/s12906-024-04597-w
Peng Z, Yang X, Zhang H, Yin M, Luo Y, Xie C (2021) MiR-29b-3p aggravates NG108-15 cell apoptosis triggered by fluorine combined with aluminum. Ecotoxicol Environ Saf 224:112658. https://doi.org/10.1016/j.ecoenv.2021.112658
Zhang C, Huo S, Fan Y, Gao Y, Yang Y, Sun D (2020) Autophagy May Be Involved in Fluoride-Induced Learning Impairment in Rats. Biol Trace Elem Res 193(2):502–507. https://doi.org/10.1007/s12011-019-01735-1
Wu J, Wang W, Liu Y, Sun J, Ye Y, Li B, Liu X, Liu H, Sun Z, Li M, Cui J, Sun D, Yang Y, Gao Y (2015) Modifying Role of GSTP1 Polymorphism on the Association between Tea Fluoride Exposure and the Brick-Tea Type Fluorosis. PLoS ONE 10(6):e0128280. https://doi.org/10.1371/journal.pone.0128280
Singh N, Verma KG, Verma P, Sidhu GK, Sachdeva S (2014) A comparative study of fluoride ingestion levels, serum thyroid hormone & TSH level derangements, dental fluorosis status among school children from endemic and non-endemic fluorosis areas. Springerplus 3:7. https://doi.org/10.1186/2193-1801-3-7
Shen J, Xu J, Wen Y, Tang Z, Li J, Sun J (2024) Carnosine ameliorates postoperative cognitive dysfunction of aged rats by limiting astrocytes pyroptosis. Neurotherapeutics 21(4):e00359. https://doi.org/10.1016/j.neurot.2024.e00359
Kelley N, Jeltema D, Duan Y, He Y (2019) The NLRP3 Inflammasome: An Overview of Mechanisms of Activation and Regulation. Int J Mol Sci 20(13). https://doi.org/10.3390/ijms20133328
Rutsch A, Kantsjo JB, Ronchi F (2020) The Gut-Brain Axis: How Microbiota and Host Inflammasome Influence Brain Physiology and Pathology. Front Immunol 11:604179. https://doi.org/10.3389/fimmu.2020.604179
Paldino E, D'Angelo V, Laurenti D, Angeloni C, Sancesario G, Fusco FR (2020) Modulation of Inflammasome and Pyroptosis by Olaparib, a PARP-1 Inhibitor, in the R6/2 Mouse Model of Huntington's Disease. Cells 9(10). https://doi.org/10.3390/cells9102286
Kupnicka P, Listos J, Tarnowski M, Kolasa-Wolosiuk A, Wasik A, Lukomska A, Barczak K, Gutowska I, Chlubek D, Baranowska-Bosiacka I (2020) Fluoride Affects Dopamine Metabolism and Causes Changes in the Expression of Dopamine Receptors (D1R and D2R) in Chosen Brain Structures of Morphine-Dependent Rats. Int J Mol Sci 21(7). https://doi.org/10.3390/ijms21072361
Hao W, Hao C, Wu C, Xu Y, Jin C (2022) Aluminum induced intestinal dysfunction via mechanical, immune, chemical and biological barriers. Chemosphere 288(Pt 2):132556. https://doi.org/10.1016/j.chemosphere.2021.132556
Hao W, Hao C, Wu C, Xu Y, Wu S, Lu X, Yang J, Jin C (2021) Aluminum impairs cognitive function by activating DDX3X-NLRP3-mediated pyroptosis signaling pathway. Food Chem Toxicol 157:112591. https://doi.org/10.1016/j.fct.2021.112591
Hao W, Zhu X, Liu Z, Song Y, Wu S, Lu X, Yang J, Jin C (2023) Aluminum exposure induces central nervous system impairment via activating NLRP3-medicated pyroptosis pathway. Ecotoxicol Environ Saf 264:115401. https://doi.org/10.1016/j.ecoenv.2023.115401
Xiao L, Li L, Huang J, Luan Y, Pan J, Gai Y, Xu Z (2023) Salidroside attenuates lipopolysaccharide-induced neuroinflammation and cognitive impairment in septic encephalopathy mice. Int Immunopharmacol 117:109975. https://doi.org/10.1016/j.intimp.2023.109975
Wu Q, Shan X, Li X, Guan J, Song F, Zhou X, Fan Y, Guo L (2025) Salidroside ameliorates neuroinflammation in autistic rats by inhibiting NLRP3/Caspase-1/GSDMD signal pathway. Brain Res Bull 220:111132. https://doi.org/10.1016/j.brainresbull.2024.111132
Yu S, Xu H, Chi X, Wei L, Cheng Q, Yang Y, Zhou C, Ding F (2018) 2-(4-Methoxyphenyl)ethyl-2-Acetamido-2-deoxy-beta-d-pyranoside (A Salidroside Analog) Confers Neuroprotection with a Wide Therapeutic Window by Regulating Local Glucose Metabolism in a Rat Model of Cerebral Ischemic Injury. Neuroscience 391:60–72. https://doi.org/10.1016/j.neuroscience.2018.09.006
Chen X, Wei J, Wang H, Peng Y, Tang C, Ding Y, Li S, Long Z, Lu X, Wang Y (2023) Effects and mechanisms of salidroside on the behavior of SPS-induced PTSD rats. Neuropharmacology 240:109728. https://doi.org/10.1016/j.neuropharm.2023.109728
Lu S, Ji N, Wang W, Lin X, Gao D, Geng D (2024) Salidroside improves cognitive function in Parkinson's disease via Braf-mediated mitogen–activated protein kinase signaling pathway. Biomed Pharmacother 177:116968. https://doi.org/10.1016/j.biopha.2024.116968
Cai Y, Chai Y, Fu Y, Wang Y, Zhang Y, Zhang X, Zhu L, Miao M, Yan T (2021) Salidroside Ameliorates Alzheimer's Disease by Targeting NLRP3 Inflammasome-Mediated Pyroptosis. Front Aging Neurosci 13:809433. https://doi.org/10.3389/fnagi.2021.809433
Ward R, Li W, Abdul Y, Jackson L, Dong G, Jamil S, Filosa J, Fagan SC, Ergul A (2019) NLRP3 inflammasome inhibition with MCC950 improves diabetes-mediated cognitive impairment and vasoneuronal remodeling after ischemia. Pharmacol Res 142:237–250. https://doi.org/10.1016/j.phrs.2019.01.035
Liu J, Ma W, Zang C, Wang G, Zhang S, Wu H, Zhu K, Xiang X, Li C, Liu K, Guo J, Li L (2021) Salidroside inhibits NLRP3 inflammasome activation and apoptosis in microglia induced by cerebral ischemia/reperfusion injury by inhibiting the TLR4/NF-kappaB signaling pathway. Ann Transl Med 9(22):1694. https://doi.org/10.21037/atm-21-5752

No competing interests reported.

graphicabstractpyropotsis.tif
Graphic abstract. A proposed model for the role of pyroptosis in fluoride neurotoxicity and neuroprotective effect of Sal. P2X7R/NF-κB/NLRP3 pathway conducted pyroptosis plays a vital role in fluoride neurotoxicity. Specifically, inhibiting P2X7R/NF-κB/NLRP3 pathway by the Sal alleviated fluoride-induced pyroptosis, prevented the resultant apoptosis and promoted neuronal survival.

Download PDF

Journal Publication

published 20 Nov, 2025

Read the published version in Biological Trace Element Research →

Editorial decision: Revision requested
03 Sep, 2025
Reviews received at journal
29 Aug, 2025
Reviewers agreed at journal
25 Aug, 2025
Reviews received at journal
24 Aug, 2025
Reviewers agreed at journal
16 Aug, 2025
Reviewers invited by journal
14 Aug, 2025
Editor assigned by journal
14 Aug, 2025
Submission checks completed at journal
14 Aug, 2025
First submitted to journal
14 Aug, 2025

You are reading this latest preprint version

Salidroside alleviates fluoride induced pyroptosis and developmental neurotoxicity through P2X7R/NF-κB/NLRP3 pathway

Status:

Journal Publication

Version 1

Abstract

Figures

Highlights

Introduction

Method and Materials

Cell culture and treatment

Animals and treatments

radial arm maze (RAM) test

Measurements of fluoride concentrations

Transmission electron microscopy (TEM) examination

Histopathological examination

Western blot analysis

Reverse transcription-quantitative real-time Polymerase Chain Reaction (RT-qPCR)

Cell viability assay

Statistical analysis

Results

Fluoride exposure significantly increased fluorine content in the serum, brain, and urine of F2 rats

Fluoride induces neurobehavioral deficits associated with pyroptosis and impairments of striatal neurons in F2 rats

Fluoride stimulates P2X7R/NF-κB/NLRP3 regulatory pathway in F2 SD rat striatal neurons

Sal inhibits fluoride induced pyroptosis and ultrastructure impairment of NG108-15 cells 下面标黄部分即剂量选择及细胞处理, 应该放在方法部分!先染氟24小时, 才进行的治疗。所有内容一定要核对和大论文一致性༁

Discussion

Conclusion

Abbreviations

Declarations

Author Contribution

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1