Hesperidin Attenuates Mercury Chloride-Induced Neurotoxicity in Rats by Modulating Oxidative Stress, Neuroinflammation, Apoptosis, Autophagy and ER Stress

doi:10.21203/rs.3.rs-8231141/v1

Download PDF

Research Article

Hesperidin Attenuates Mercury Chloride-Induced Neurotoxicity in Rats by Modulating Oxidative Stress, Neuroinflammation, Apoptosis, Autophagy and ER Stress

https://doi.org/10.21203/rs.3.rs-8231141/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Mercury chloride (HgCl₂) is a well-known environmental toxicant that can induce neurotoxicity through oxidative stress, neuroinflammation, endoplasmic reticulum (ER) stress, dysregulated autophagy, and apoptosis. This study evaluated the potential neuroprotective effects of hesperidin (HES), a bioactive flavonoid with antioxidant and anti-inflammatory properties, against HgCl₂-induced brain injury in rats. Sixty male Sprague Dawley rats received 1.23 mg/kg HgCl₂ intraperitoneally for 7 days, while HES was administered orally at doses of 100, 200, or 400 mg/kg. HgCl₂ exposure resulted in elevated lipid peroxidation, impaired antioxidant status, increased pro-inflammatory cytokines (TNF-α, IL-1β, IL-6), and reduced IL-10 levels. Upregulation of Bax and caspase-3, downregulation of Bcl-2 and BDNF, along with increased GFAP immunoreactivity, indicated enhanced neuronal apoptosis and astrocyte activation. Furthermore, increased Beclin-1, LC3A/B, and ER stress-related markers (GRP78, PERK, ATF4, XBP1, IRE1, CHOP) suggested disturbances in cellular homeostasis. HES treatment—most notably at 400 mg/kg—attenuated oxidative stress, improved antioxidant enzyme activities, reduced pro-inflammatory responses while partially restoring IL-10, and modulated apoptosis, autophagy, and ER stress-associated pathways. In addition, increased BDNF levels following HES administration may indicate improved neuronal plasticity. Collectively, these findings suggest that hesperidin is a promising neuroprotective candidate against HgCl₂-induced neurotoxicity by modulating multiple molecular pathways involved in oxidative damage, inflammation, apoptosis, autophagy, and ER stress.

Mercury Chloride

Hesperidin

Autophagy

Inflammation

Apoptosis

Endoplasmic Reticulum Stress

Mercury and its compounds have long remained a critical topic of investigation in the fields of environmental toxicology and neuroscience. Among the various forms of mercury—elemental mercury, inorganic mercury salts, and organic mercury compounds—the inorganic compound mercury chloride (HgCl₂) is of particular concern due to its tendency to accumulate in biological tissues and its long half-life, making it a significant environmental and public health threat [1, 2]. Although mercury exposure can affect multiple organ systems, the central nervous system is one of the most vulnerable targets because both organic and inorganic forms are capable of crossing the blood–brain barrier. This vulnerability is supported by evidence showing that HgCl₂ exposure leads to irreversible neurological outcomes, including impairments in motor coordination, learning, and memory [3–7].

At the molecular level, HgCl₂-induced neurotoxicity is known to progress through multiple interconnected mechanisms. Oxidative stress, driven by excessive production of reactive oxygen species, represents one of the earliest and most prominent outcomes of exposure, leading to damage in lipids, proteins, and DNA. Inflammatory pathways—characterized by microglial activation and NF-κB-mediated cytokine release—further exacerbate this oxidative disruption, ultimately compromising synaptic integrity [8]. Apoptosis is also a key component of this mechanism, with studies reporting activation of mitochondrial pathways characterized by increased Bax and caspase-3 expression and a corresponding decrease in Bcl-2 levels [9]. In addition, endoplasmic reticulum (ER) stress triggered by the accumulation of misfolded proteins is characterized by increased expression of markers such as GRP78, PERK, ATF4, XBP1, IRE1, and CHOP, and when prolonged, this response accelerates cellular death [10, 11]. Taken together, these findings indicate that HgCl₂ contributes to neurodegeneration through an integrated toxicity network involving oxidative stress, inflammation, apoptosis, and ER stress.

In recent years, the therapeutic potential of natural antioxidant compounds against heavy metal toxicity has gained increasing attention. Among these compounds, the flavonoid hesperidin stands out for its strong free radical–scavenging capacity, its ability to reduce oxidative damage, support endogenous antioxidant defenses, and modulate inflammatory responses [12]. Furthermore, studies in various experimental models have reported that hesperidin suppresses inflammation and apoptosis while providing both structural and functional protection to neural tissue [13]. In this context, hesperidin emerges as a promising protective agent against HgCl₂-induced neurotoxicity.

In light of this evidence, the present study aimed to investigate the protective effects of hesperidin on the multifaceted neurotoxic mechanisms triggered by HgCl₂ exposure, including oxidative stress, inflammation, apoptosis, autophagy, and ER stress.

Chemicals

Mercury chloride (HgCl₂; CAS No: 7487-94-7) and hesperidin (CAS No: 520-26-3, ≥ 80% (HPLC)) used in this study were obtained from Sigma-Aldrich (St. Louis, MO, USA). The ELISA kits employed in the experiments were supplied by YL-Biont (Shanghai, China) and included the Rat Malondialdehyde (MDA) ELISA Kit (YLA0029RA), Rat Superoxide Dismutase (SOD) ELISA Kit (YLA0115RA), Rat Glutathione (GSH) ELISA Kit (YLA1511RA), Rat Interleukin-1β (IL-1β) ELISA Kit (YLA0030RA), Rat Interleukin-6 (IL-6) ELISA Kit (YLA0031RA), Rat Interleukin-10 (IL-10) ELISA Kit (YLA0440RA), and Rat Tumor Necrosis Factor-α (TNF-α) ELISA Kit (YLA0118RA). All analyses were performed in accordance with the manufacturers’ instructions.

Groups and Experimental Procedure

Sixty male Sprague Dawley rats (220–250 g, 12 weeks old) used in this study were obtained from the Atatürk University Medical Experimental Research Center (ATADEM, Erzurum, Turkey). Following a 7-day acclimatization period, animals were housed in bedding-lined cages enriched with environmental stimulation materials. Throughout the experiment, temperature was maintained at 25 ± 2°C with 55 ± 10% relative humidity under a 12-h light/dark cycle, and food and water were provided ad libitum. Rats were allocated to experimental groups using a computer-based simple randomization method, and all procedures were performed at the same time of day to minimize circadian variability. The experimental protocol was approved by the Atatürk University Animal Experiments Ethics Committee (Approval No: 2024/13/299) and conducted in accordance with ethical guidelines. Hesperidin was dissolved in distilled water and administered intragastrically (1 mL/kg).

Control: Rats received 1 mL distilled water orally once daily for 7 days.

HES400: Rats received hesperidin at 400 mg/kg orally once daily for 7 days.

HgCl₂: Rats were administered HgCl₂ at 1.23 mg/kg intraperitoneally once daily for 7 days [14].

HgCl₂ + HES100: Rats received HgCl₂ (1.23 mg/kg, i.p.) followed 30 minutes later by hesperidin (100 mg/kg, oral) once daily for 7 days [15].

HgCl₂ + HES200: Rats received HgCl₂ (1.23 mg/kg, i.p.) followed 30 minutes later by hesperidin (200 mg/kg, oral) once daily for 7 days [15].

HgCl₂ + HES400: Rats received HgCl₂ (1.23 mg/kg, i.p.) followed 30 minutes later by hesperidin (400 mg/kg, oral) once daily for 7 days [15].

Following the completion of all treatments, rats underwent behavioral testing immediately before sacrifice. All behavioral assessments were performed on the same day by an investigator blinded to the experimental groups.

Behavioral Tests

Open Field Test (OFT)

This test was used to evaluate locomotor activity and anxiety-like behavior. The open field apparatus consisted of a square arena (42 × 42 × 42 cm) equipped with an infrared-based tracking system (MAY ACT 508, Commat, Ankara, Türkiye). No external light source was used during testing; locomotor parameters were detected exclusively through infrared sensors to prevent light-induced variations in activity. Each rat was gently placed in the center of the arena and allowed to explore freely for 10 minutes. Total distance traveled, immobility duration, and rearing activity were automatically automatically detected and quantified. After each trial, the arena was thoroughly cleaned with a non-scented disinfectant to eliminate any odors, fecal traces, or urine residues that could influence the subsequent animal’s behavior.

Elevated Plus Maze (EPM)

Anxiety-like behavior was further evaluated using the EPM test. The maze consisted of two open arms and two closed arms, each 10 cm wide and 1 m in length, intersecting at a central platform elevated above the floor. After each test session, the apparatus was cleaned to prevent odor-related bias. The time spent in open and closed arms, as well as the number of entries into open arms, was recorded for 5 minutes using EthoVision XT 10.0 video-tracking software.

Tissue Collection

Twenty-four hours after the final administration, all rats were sacrificed under moderate sevoflurane anesthesia (Sevorane®; Queenborough, UK), and brain tissues were collected for biochemical and molecular analyses. A portion of the brain tissue was gently rinsed with physiological saline and fixed in 10% neutral buffered formalin for histopathological and immunohistochemical examinations. The remaining tissues were again rinsed with physiological saline, rapidly frozen in liquid nitrogen, and stored at − 80°C until further biochemical and molecular analyses were performed.

Biochemical Analyses

Oxidative, antioxidant, and inflammatory parameters—including malondialdehyde (MDA), superoxide dismutase (SOD), glutathione (GSH), and the cytokines TNF-α, IL-6, IL-1β, and IL-10—were quantified spectrophotometrically using a BioTek EPOCH2 microplate reader at a wavelength of 450 nm. Brain tissues were homogenized in ice-cold phosphate buffer, centrifuged, and the resulting supernatants were analyzed. All biochemical measurements were normalized to gram of tissue to ensure accurate comparison across samples.

Histopathological Examinations

Brain samples collected at the end of the experiment were fixed in 10% neutral buffered formalin for 48 hours and subsequently processed through routine tissue preparation procedures before being embedded in paraffin blocks. Sections of 4 µm thickness were obtained from each block, stained with hematoxylin–eosin (H&E), and examined under a light microscope (Leica, Flexacam i5). Histopathological evaluation focused on detecting neuronal degeneration and necrosis in the cerebral cortex. Observed alterations were graded semi-quantitatively according to severity as absent (−), mild (+), moderate (++), or severe (+++) [16].

Immunohistochemical Examinations

For immunohistochemical analyses, tissue sections mounted on adhesive (poly-L-lysine–coated) slides following routine tissue processing were deparaffinized and rehydrated. Endogenous peroxidase activity was blocked by incubating the sections in 3% H₂O₂ for 10 minutes. Antigen retrieval was then performed by heating the tissues in 1% TRIS-EDTA buffer (pH 6.1, 100X), followed by cooling to room temperature. To prevent nonspecific background staining, the sections were incubated with a protein block for 5 minutes. Subsequently, primary antibodies—BDNF (Cat. No: DF6387, dilution 1:100, Affinity) and GFAP (Cat. No: ab7260, dilution 1:100, Abcam)—were applied and incubated according to the manufacturers’ instructions. After the application of secondary antibodies, 3-amino-9-ethylcarbazole (AEC) chromogen was applied for visualization. Stained sections were examined under a light microscope (Leica, Flexacam i5). Following microscopic evaluation, ImageJ software was used to quantify immunopositive staining intensity [17].

Immunofluorescence Examinations

For immunofluorescence analysis, tissue sections mounted on adhesive (poly-L-lysine–coated) slides were deparaffinized and rehydrated. Antigen retrieval was performed by heating the sections in 1% citrate buffer (pH 6.1, 100X), followed by cooling to room temperature. To reduce nonspecific background staining, the sections were incubated with a protein block for 5 minutes. Primary antibodies—BAX (Cat. No: sc-7480, mouse monoclonal, 1:100), Bcl-2 (Cat. No: sc-7382, mouse monoclonal, 1:100), and Caspase-3 (Cat. No: sc-56053, mouse monoclonal, 1:100)—were then applied and incubated according to the manufacturers’ protocols. After primary incubation, a fluorescent secondary antibody, fluorescein isothiocyanate (FITC; Cat. No: sc-2359, mouse monoclonal, 1:1000), was applied and the sections were kept in the dark for 45 minutes. Subsequently, mounting medium containing 4′,6-diamidino-2-phenylindole (DAPI; Cat. No: ab104140, 1:200) was added, and the sections were incubated for 5 minutes in the dark before coverslipping. The stained tissues were examined under a fluorescence microscope equipped with appropriate fluorescence attachments (Zeiss AXIO, Germany) [18].

Western Blot Analyses

Western blot analysis was conducted to determine protein expression levels in brain tissues. Approximately 50 mg of brain tissue was homogenized in RIPA lysis buffer supplemented with a protease inhibitor cocktail (Santa Cruz Biotechnology, sc-24948, USA), followed by centrifugation at 16,000 g for 20 minutes at + 4°C to obtain the supernatants. Total protein concentrations were quantified using the BCA Protein Assay Kit (Thermo Scientific, Pierce BCA, 23225, USA) based on a BSA standard curve. Equal amounts of protein were separated by SDS-PAGE using acrylamide/bis-acrylamide solution (Bio-Rad, 161 − 0156, USA) under reducing conditions. Proteins were transferred onto PVDF membranes (Bio-Rad, 162–0177, USA) using a wet transfer system, after which membranes were blocked in TBST containing 5% non-fat dry milk. Membranes were then incubated overnight at + 4°C with primary antibodies targeting GRP78 (≈ 55–90 kDa, sc-13539), IRE1α (≈ 90–132 kDa, sc-390960), XBP1 (≈ 20–37 kDa, sc-8015), PERK (≈ 130–200 kDa, sc-377400), CHOP (≈ 23–34 kDa, sc-7351), ATF4 (≈ 45–55 kDa, sc-390063), and β-Tubulin (≈ 45–55 kDa, sc-5274). β-Tubulin served as the internal loading control.

Following primary incubation, membranes were washed and incubated with HRP-conjugated Goat anti-Mouse IgG-HRP secondary antibody (1:1000, sc-2005, Santa Cruz Biotechnology, USA). Protein bands were visualized using Clarity™ Western ECL Substrate (Bio-Rad, 170–5061, USA) and imaged using the ChemiDoc™ Imaging System (Bio-Rad, USA). Densitometric quantification of band intensities was performed in Image Lab 6.1 software, and target protein expression levels were normalized to β-Tubulin.

qRT-PCR Analyses

Primers required to quantify the mRNA transcript levels of Beclin-1, LC3A, and LC3B genes were designed using the Primer-BLAST tool (Table 1).

Table 1
RT-PCR Primer Sequences
Gene	Sequences (5’-3’)	Accession No
LC3A	F: GACCATGTTAACATGAGCGA R: CCTGTTCATAGATGTCAGCG	NM_199500.2
LC3B	F: GAGCTTCGAACAAAGAGTGG R: CGCTCATATTCACGTGATCA	NM_022867.2
Beclin-1	F: TCTCGTCAAGGCGTCACTTC R: CCATTCTTTAGGCCCCGACG	NM_053739.2
B-actin	F: CAGCCTTCCTTCCTGGGTATG R: AGCTCAGTAACAGTCCGCCT	NM_031144.3

Total RNA was extracted from 100 mg of brain tissue using QIAzol Reagent (QIAGEN, USA). Tissue samples were homogenized in 1 mL of QIAzol, followed by phase separation with 200 µL chloroform and centrifugation at 12,000 × g for 20 minutes at 4°C. The upper aqueous phase was mixed with 500 µL isopropanol and centrifuged at 12,000 × g for 10 minutes to precipitate RNA. The resulting pellet was washed with 75% ethanol, recentrifuged at 7,500 × g for 5 minutes, air-dried, and dissolved in RNase-free DEPC-treated water. RNA concentration and purity were determined spectrophotometrically at 260/280 nm, and samples with A260/280 ratios between 1.8 and 2.2 were used for subsequent analyses.

To eliminate genomic DNA contamination, total RNA was treated with DNase I (Thermo Scientific, USA). A total of 1 µg RNA per sample was reverse-transcribed into cDNA using the miScript Reverse Transcription Kit (QIAGEN, USA) according to the manufacturer’s instructions. Synthesized cDNA was quantified spectrophotometrically, diluted to equal working concentrations, and used for quantitative real-time PCR.

qRT-PCR was performed using a QIAGEN Real-Time PCR System with SYBR Green 2X Rox Master Mix (QIAGEN, USA). Each reaction was carried out in triplicate and included gene-specific primers (Beclin-1, LC3A, LC3B) together with β-actin as the housekeeping reference gene. The thermal cycling conditions consisted of an initial activation at 95°C for 10 minutes, followed by 40 cycles of denaturation at 95°C for 15 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds. Melt-curve analysis was performed to verify amplification specificity (Table 1).

Gene expression levels were calculated using the 2^{^−ΔΔCt} method after normalization to β-actin [19].

Statistical Analysis

All data were expressed as mean ± standard error of the mean (SEM). The normality of data distribution was assessed using the Shapiro–Wilk test. For normally distributed variables (biochemical, behavioral, immunohistochemical, and immunofluorescence measurements), group differences were analyzed using one-way analysis of variance (one-way ANOVA) followed by Tukey’s post hoc test. Non-normally distributed data, including H&E histopathological scores, were evaluated using the Kruskal–Wallis test with Dunn’s multiple comparison test. To minimize type I error related to multiple testing across numerous outcome variables, the false discovery rate (FDR) approach (Benjamini–Hochberg procedure) was applied where appropriate. All statistical analyses were performed using GraphPad Prism 9.0 (GraphPad Software, San Diego, CA, USA), and p < 0.05 was considered statistically significant.

Effects of Hesperidin on Behavioral Outcomes in Mercury Chloride-Induced Neurotoxicity

In this study, mercury chloride was found to increase anxiety-like behaviors and impair locomotor activity in rats, while hesperidin—particularly at lower doses—significantly ameliorated these adverse effects. Findings from the Elevated Plus Maze and locomotor activity assessments demonstrate the neuroprotective potential of hesperidin, indicating that it may exert protective effects against HgCl₂-induced anxiety and motor behavior disturbances.

Elevated Plus Maze Test

The Elevated Plus Maze (EPM) test results demonstrated that mercury chloride (HgCl₂)-induced brain injury increased anxiety-like behavior, while hesperidin exerted a partially protective effect against these alterations. According to the graphical data, the HgCl₂ group spent a significantly longer duration in the closed arms, indicating heightened anxiety levels. Statistically, the HgCl₂ group spent more time in the closed area compared to the control group (p < 0.05). Moreover, a significant difference was observed between the HgCl₂ and HgCl₂+HES100 groups (p < 0.01), revealing that low-dose hesperidin (100 mg/kg) substantially reduced HgCl₂-induced anxiety-like behavior. Although the HgCl₂+HES200 and HgCl₂+HES400 groups also showed reduced closed-arm time compared to the HgCl₂ group, these differences were not statistically significant (ns, Fig. 1).

This finding suggests that the 200 and 400 mg/kg doses of hesperidin do not exert a marked restorative effect, whereas the 100 mg/kg dose may provide a stronger protective action. On the other hand, when HES400 was administered alone, it did not produce a significant difference compared with the control group (ns), indicating that hesperidin by itself does not alter anxiety-like behavior. Overall, in the EPM test, HgCl₂ administration increased anxiety, while hesperidin—particularly at the 100 mg/kg dose—significantly reduced this effect. In addition, a non-linear dose–response pattern was observed; that is, the low dose was effective, whereas higher doses did not provide the same level of protection.

The statistical findings show that the HgCl₂ group differed significantly from both the control and HES400 groups (p < 0.05), and that the most pronounced difference occurred between HgCl₂ and HgCl₂+HES100 (p < 0.01). No other comparisons reached statistical significance (ns). Therefore, the EPM test results indicate that hesperidin may exert a protective effect against anxiety-like behaviors, particularly at specific doses, and that this effectiveness varies depending on the dose administered (Fig. 2).

Locomotor Activity Test

Locomotor activity analysis revealed that HgCl₂ markedly disrupted behavioral performance across all measured parameters. Stereotypic movements were significantly reduced in the HgCl₂ group compared with the control and HES400 groups (p < 0.0001). Co-administration of hesperidin (100, 200, and 400 mg/kg) significantly increased stereotypic behavior relative to HgCl₂ alone (p < 0.001).

Ambulatory activity was also diminished following HgCl₂ exposure (p < 0.05–0.01), whereas hesperidin co-treatment restored locomotor performance in a dose-dependent manner, with the HgCl₂+HES400 group showing values comparable to controls (p < 0.0001).

Similarly, vertical activity (rearing count) was significantly suppressed in HgCl₂-treated rats (p < 0.01). Hesperidin increased rearing behavior in all co-treatment groups, although this improvement remained partial (Fig. 3).

In horizontal activity, a reduction was detected in the HgCl₂ group (p < 0.05), and activity was also lower in the HgCl₂+HES100 group; although a recovery trend was observed at higher doses (200–400 mg/kg), most comparisons did not reach statistical significance (ns). When the resting percentage was examined, a marked increase was observed in the HgCl₂ group (p < 0.05, p < 0.01), indicating elevated motor inhibition. In the hesperidin-treated groups, the resting percentage decreased significantly (p < 0.01) and approached control levels.

For the total distance parameter, a significant reduction was identified in the HgCl₂ group compared with the control and HES400 groups (p < 0.05). With hesperidin co-administration, total distance showed a recovery trend, and in the HgCl₂+HES100 group this increase reached statistical significance (p < 0.05). Overall, HgCl₂ suppressed stereotypic and exploratory behaviors, reduced horizontal movements, increased resting time, and decreased total distance. Hesperidin significantly improved most of these impairments—particularly at the low dose (100 mg/kg)—while providing partial but statistically non-significant recovery in certain parameters (such as horizontal activity).

Taken together, these findings demonstrate that HgCl₂ severely disrupts locomotor and behavioral capacity in rats, whereas hesperidin exhibits neuroprotective effects by ameliorating these deficits, especially at lower doses (Fig. 4).

Regulatory Effects of Hesperidin on MDA, SOD, and GSH in the Mercury Chloride-Induced Oxidative Stress Model

The study demonstrated that mercury chloride (HgCl₂) administration caused marked alterations in oxidative stress markers (MDA, SOD, and GSH), while hesperidin treatment ameliorated these adverse effects in a dose-dependent manner.

HgCl₂ administration significantly increased MDA levels compared with the control group (p < 0.001), indicating a strong induction of lipid peroxidation by mercury exposure. Hesperidin treatment reduced MDA levels in a dose-dependent manner. In the HgCl₂ + HES100 group, a decrease in MDA was observed; however, the values remained higher than those of the control group (p < 0.001). In the HgCl₂ + HES200 group, the reduction became more pronounced (p < 0.05), and in the HgCl₂ + HES400 group, MDA levels approached control values, with no statistically significant difference between the two (p > 0.05, Fig. 5).

HgCl₂ administration led to a significant reduction in both SOD activity and GSH levels compared with the control group (p < 0.001). This decrease indicates suppression of the antioxidant defense system, which plays a crucial role in combating oxidative stress, and reflects a disruption of cellular redox balance. Hesperidin treatment produced dose-dependent improvements in both parameters. In the HgCl₂ + HES100 group, SOD and GSH levels remained low (p < 0.001), whereas in the HgCl₂ + HES200 group, a significant recovery was observed in both markers (p < 0.01). With high-dose hesperidin (HgCl₂ + HES400), SOD and GSH levels reached values comparable to those of the control group, with no statistically significant differences detected (p > 0.05, Fig. 5).

Regulatory Effects of Hesperidin on the Inflammatory Response Induced by HgCl₂ (TNF-α, IL-1β, IL-6, IL-10, NF-κB, and TLR4)

In this study, HgCl₂ exposure was found to increase pro-inflammatory cytokines (TNF-α, IL-1β, IL-6) and inflammatory signaling pathways (NF-κB, TLR4), while reducing the level of the anti-inflammatory cytokine IL-10. Hesperidin treatment corrected these alterations in a dose-dependent manner.

HgCl₂ administration led to marked increases in TNF-α, IL-1β, and IL-6 levels compared with the control group (p < 0.001), indicating a strong pro-inflammatory response induced by mercury. Hesperidin treatment suppressed these cytokines in a dose-dependent manner. In the HgCl₂+HES100 group, TNF-α levels remained elevated (p < 0.01), while significant reductions were observed for IL-1β (p < 0.001) and IL-6 (p < 0.01). In the HgCl₂+HES200 group, all parameters showed a more pronounced decrease, with IL-1β and IL-6 both reaching significance at the p < 0.05 level. High-dose hesperidin (HgCl₂+HES400) reduced TNF-α, IL-1β, and IL-6 levels to values very close to those of the control group, with no statistically significant differences detected (p > 0.05, Fig. 6).

Anti-inflammatory cytokine IL-10 levels were significantly reduced by HgCl₂ administration compared with the control group (p < 0.001), demonstrating that mercury toxicity weakens inflammation-suppressing mechanisms. Hesperidin treatment increased IL-10 levels in a dose-dependent manner. No significant improvement was observed in the HgCl₂+HES100 group, where IL-10 levels remained low (p < 0.001), whereas the HgCl₂+HES200 group showed a marked elevation (p < 0.05). In the HgCl₂+HES400 group, IL-10 levels reached values similar to the control group, and no significant difference was recorded (p > 0.05, Fig. 6).

HgCl₂ exposure significantly increased NF-κB and TLR4 levels compared with the control group (p < 0.001), both of which play key roles in initiating inflammatory responses. Hesperidin treatment dose-dependently suppressed these elevations. In the HgCl₂+HES100 group, NF-κB and TLR4 levels remained high (p < 0.001). In the HgCl₂+HES200 group, NF-κB showed a significant reduction (p < 0.01), and TLR4 decreased significantly (p < 0.05). In the HgCl₂+HES400 group, both parameters reached values very similar to the control group, with no statistically significant differences observed (p > 0.05, Fig. 6).

Histopathological Findings

Histopathological examination of brain samples revealed that neurons in the control and HES400 groups exhibited normal morphology. In contrast, the HgCl₂ group showed severe degenerative and necrotic changes in neuronal cells. In the HgCl₂ + HES100 group, these pathological findings were reduced, although the improvement did not reach statistical significance (p > 0.05). In the HgCl₂ + HES200 and HgCl₂ + HES400 groups, the degenerative changes were significantly decreased compared with the HgCl₂ group (p < 0.05) (Fig. 7).

Immunohistochemical and Immunofluorescence Findings

In the IHC and IF staining of brain samples, strong expression levels of BDNF (Fig. 7), GFAP (Fig. 7), and Bcl-2 (Fig. 8) were observed in the control and HES400 groups, while low levels of BAX (Fig. 9) and Caspase-3 (Fig. 10) expression were detected. In the HgCl₂ group, BDNF, GFAP, and Bcl-2 expression levels were significantly reduced (p < 0.05) compared with the control and HES400 groups, whereas BAX and Caspase-3 levels were significantly increased (p < 0.05). In the treatment groups, these expression patterns approached those of the control and HES400 groups in a dose-dependent manner. The scores obtained from histopathological, immunohistochemical, and immunofluorescence evaluations, along with their statistical analyses, are presented in Fig. 11.

Protective Effect of Hesperidin Against HgCl₂-Induced Endoplasmic Reticulum Stress

To evaluate endoplasmic reticulum (ER) stress–related alterations in protein expression within brain tissue, CHOP, XBP1, GRP78, PERK, ATF4, and IRE1 proteins were examined by Western blot analysis. The effects of different doses of hesperidin (100, 200, 400 mg/kg) were compared against the stress response induced by HgCl₂ exposure. Protein levels were normalized to β-tubulin and analyzed densitometrically.

CHOP, XBP1, and GRP78 protein expression levels were significantly increased in the HgCl₂-treated group compared with the control (CHOP p < 0.001; XBP1 p < 0.001; GRP78 p < 0.01). Hesperidin administration reduced these elevations in a dose-dependent manner; in the HgCl₂+HES100 group, significant decreases were observed for CHOP (p < 0.01) and XBP1 (p < 0.01). GRP78 expression in the HgCl₂+HES100 group did not show a significant difference compared with the control (p > 0.05). In the HgCl₂+HES200 group, CHOP (p > 0.05), XBP1 (p < 0.05), and GRP78 (p > 0.05) levels approached control values. In the HgCl₂+HES400 group, CHOP, XBP1, and GRP78 expression levels were not significantly different from the control group (p > 0.05, Fig. 12).

PERK, ATF4, and IRE1 protein expression levels were markedly increased in the HgCl₂ group compared with the control (PERK p < 0.001; ATF4 p < 0.001; IRE1 p < 0.001). In the HgCl₂+HES100 group, PERK levels showed a significant reduction (p < 0.01), whereas ATF4 levels did not exhibit a significant change and were close to control values (p > 0.05). For IRE1, a significant difference was observed in the HgCl₂+HES100 group (p < 0.001), indicating that its levels remained significantly altered compared with the control. In the HgCl₂+HES200 group, both PERK (p < 0.05) and IRE1 (p < 0.05) levels showed significant decreases. ATF4 levels in this group did not show a significant difference compared with the control (p > 0.05). In the HgCl₂+HES400 group, PERK, ATF4, and IRE1 expression levels were close to control values, and no statistically significant differences were detected among the groups (p > 0.05, Fig. 12).

Effects of Hesperidin on HgCl₂-Induced Autophagic Response (Beclin-1, LC3A, LC3B) at the mRNA Expression Level

To determine the activation level of the autophagic process, the relative expression levels of the autophagy-related genes Beclin-1, LC3A, and LC3B were evaluated.

HgCl₂ administration led to significant increases in the mRNA expression levels of Beclin-1, LC3A, and LC3B compared with the control group (p < 0.001). In the HgCl₂+HES100 group, all three autophagy markers remained elevated, with increases in Beclin-1, LC3A, and LC3B reaching statistical significance at the p < 0.001 level. In the HgCl₂+HES200 group, Beclin-1 expression differed significantly from the control group at the p < 0.001 level, while LC3A and LC3B expression levels differed at the p < 0.01 level. In the HgCl₂+HES400 group, Beclin-1 expression was significantly different from the control (p < 0.01), and LC3A expression showed a significant difference at the p < 0.05 level. In contrast, LC3B levels in this group were close to control values, with no statistically significant difference observed (p > 0.05). Additionally, in the HES400 group, Beclin-1 levels were lower than those of the control group (p < 0.05), while LC3A and LC3B levels were similar to the control (Fig. 13).

Mercury chloride (HgCl₂) is a well-recognized environmental toxicant that exerts its neurotoxic effects through a complex and interconnected network of molecular disturbances, including oxidative stress, inflammation, mitochondrial dysfunction, apoptosis, autophagy, and endoplasmic reticulum (ER) stress [5, 20, 21]. These mechanisms interact in a nonlinear manner and collectively contribute to synaptic dysfunction, impaired neurotrophic support, glial reactivity, and ultimately neurodegeneration [22–25]. Growing evidence suggests that natural flavonoids, particularly hesperidin, possess broad-spectrum protective effects due to their multimodal antioxidant, anti-inflammatory, and cytoprotective properties [26–30]. In this context, the present study demonstrates that hesperidin provides multi-level neuroprotection against HgCl₂-induced injury by modulating key pathological pathways and restoring molecular, cellular, and behavioral integrity.

Behaviorally, HgCl₂ exposure significantly increased anxiety-like responses and impaired locomotor activity. Interestingly, hesperidin exhibited a non-linear dose–response, with the 100 mg/kg dose showing notable efficacy in EPM parameters, while higher doses more strongly influenced oxidative and inflammatory markers. Such non-linear patterns have been reported in other toxicological models, where flavonoids exert optimal behavioral effects at lower doses while higher doses more prominently regulate molecular pathways [31, 32]. The improvements in locomotor and anxiety-related behaviors observed in our study correlate with the restoration of BDNF levels and reduced glial activation, suggesting that hesperidin’s behavioral benefits may be partly mediated through the recovery of neurotrophic signaling and astrocytic homeostasis.

Oxidative stress represents one of the earliest and most dominant consequences of HgCl₂ neurotoxicity. Consistent with previous findings, we observed marked increases in MDA levels and reductions in SOD and GSH activities, indicating significant impairment of endogenous antioxidant defenses [21–23, 33]. Hesperidin, particularly at 400 mg/kg, effectively restored these parameters. This aligns with extensive literature showing that hesperidin enhances antioxidant capacity, stabilizes redox homeostasis, and prevents oxidative membrane damage through direct ROS scavenging and upregulation of endogenous antioxidants [27, 28, 34, 35]. Since oxidative stress amplifies downstream pathways such as mitochondrial dysfunction, apoptosis, and ER stress, the robust antioxidant response induced by hesperidin likely played a central role in the broad protective profile observed in this study.

Inflammatory activation constitutes another major mechanism in HgCl₂-induced neurotoxicity. Our findings showed elevated TNF-α, IL-1β, and IL-6 levels and suppressed IL-10 in the toxic group, consistent with earlier reports indicating that heavy metals activate microglia, enhance NF-κB signaling, and disrupt cytokine balance [5, 20, 36]. Hesperidin significantly reduced pro-inflammatory cytokines and restored IL-10 levels, in agreement with studies demonstrating that flavonoids inhibit Toll-like receptor signaling, reduce NF-κB activation, and prevent glial reactivity [5, 12, 26, 33, 37, 38]. The normalization of cytokine balance observed here likely contributed to the preservation of neuronal morphology and the improvement in behavioral performance.

Histopathological examinations revealed substantial neuronal degeneration and necrosis in the HgCl₂ group, confirming previous findings of heavy-metal-induced cortical atrophy, synaptic deterioration, and neuronal shrinkage[26, 39]. Hesperidin treatment—especially at 200 and 400 mg/kg—significantly reduced these pathological alterations, supporting its neuroprotective role through antioxidant and anti-inflammatory mechanisms. This is consistent with earlier studies showing that hesperidin protects neural structure in various models of neurotoxicity by stabilizing cellular membranes and preventing excessive excitotoxic and inflammatory damage [40, 41].

Apoptotic dysregulation is a key contributor to mercury-induced neuronal injury. The increased Bax and caspase-3 expression and reduced Bcl-2 levels observed in our study align with previous reports of mercury-induced mitochondrial destabilization and caspase activation [4, 5, 20, 26]. Hesperidin significantly reversed these changes, demonstrating strong anti-apoptotic activity. These results are supported by findings from Küçükler (2024), Khezri (2024), and Kumar (2024), who reported that hesperidin modulates intrinsic apoptotic pathways by reducing ROS-driven mitochondrial dysfunction and restoring anti-apoptotic proteins [12, 27, 28].

Neurotrophic factor disruption and glial activation represent additional pathological consequences of mercury exposure. The reduced BDNF levels observed in the HgCl₂ group are consistent with diminished synaptic plasticity and impaired neuronal resilience [21, 22]. Meanwhile, elevated GFAP expression indicates astrocytic activation and progression of neuroinflammation [12, 28]. Hesperidin dose-dependently restored BDNF and strongly suppressed GFAP expression, suggesting that it improves both neuronal support systems and glial homeostasis [27, 42]. Restoration of BDNF is particularly important, as it enhances synaptic recovery, promotes neuronal survival, and may underlie the behavioral improvements observed in this study.

ER stress and unfolded protein response (UPR) activation constitute another major mechanism of mercury-induced neurotoxicity. Consistent with Rana (2020) and Demircan (2024), we observed significant elevations in GRP78, PERK, ATF4, XBP1, and CHOP, indicative of UPR activation and pro-apoptotic ER stress signaling [43–46]. Hesperidin robustly reduced these markers, consistent with evidence that flavonoids attenuate PERK/ATF4/CHOP-mediated ER dysfunction and protect neurons from misfolded-protein–associated apoptosis [34, 37, 47]. The strong modulation of ER stress observed here highlights hesperidin’s potential to target deep cellular stress pathways not typically addressed by classical antioxidants.

Autophagic dysregulation also contributes to mercury-induced neuronal injury. Elevated Beclin-1 and LC3A/B expression in the HgCl₂ group reflects pathological activation of autophagy [38, 48, 49]. Hesperidin attenuated these elevations, particularly at high doses, demonstrating its ability to prevent excessive autophagic signaling. This is consistent with Varışlı (2022) and Kahkesh (2025), who reported that hesperidin has a context-dependent regulatory role, enhancing autophagy when insufficient and suppressing it when excessive [50, 51]. This bidirectional modulation underscores hesperidin’s ability to restore autophagic balance under toxic stress conditions.

Taken together, the results of this study demonstrate that hesperidin exerts broad-spectrum neuroprotective effects against mercury chloride–induced neurotoxicity by modulating several key pathological pathways. By restoring redox homeostasis, reducing pro-inflammatory cytokine release, normalizing apoptotic protein expression, attenuating ER stress responses, and preventing excessive autophagic activation, hesperidin effectively protected neuronal tissue at molecular, cellular, and behavioral levels. Furthermore, its ability to enhance BDNF expression while suppressing GFAP-mediated astrocytic activation highlights its supportive role in maintaining synaptic plasticity and neural network integrity. Overall, these findings indicate that hesperidin—particularly at higher doses—may represent a promising preclinical neuroprotective agent capable of mitigating heavy metal–induced neuronal damage. This work provides a solid experimental foundation for future studies aimed at elucidating hesperidin’s translational potential in environmental neurotoxicant exposure and in disorders characterized by oxidative and inflammatory neurodegeneration.

Funding

This study was supported by the Atatürk University Scientific Research Projects Coordinator (Project No: 2025/15153). We are grateful to Atatürk University, Turkey.

Competing Interests

The authors declare that there are no financial or non-financial competing interests that could have influenced the work reported in this manuscript.

Author Contributions

The study's conception and design involved the active participation of all the authors. Material preparation, data collection, and analysis were conducted by Samet TEKİN, Merve BOLAT, Emin ŞENGÜL, Burak Batuhan LAÇİN, Ömercan ALAT, Tuba DOĞAN, Burak ÇINAR, Furkan AYKURT, Mehmet Emin KANAT, Mohamad WARDA, Ahmet HACIMÜFTÜOĞLU. Pathology studies were performed by Serkan YILDIRIM and İsmail BOLAT. Both the initial draft and the final scientifically refined version of the manuscript were skillfully crafted by Samet TEKİN, Mohamad WARDA, Ahmet HACIMÜFTÜOĞLU. The manuscript underwent critical review and refinement in subsequent iterations, with valuable input from all the authors. The final version of the manuscript was thoroughly examined, assessed, and unanimously approved by all the authors.

Data availability

The datasets generated and/or analyzed during the current study are not publicly available due to institutional restrictions and the need to protect laboratory raw data integrity but are available from the corresponding author on reasonable request.

Ethics Approval

This study protocol was approved by the Atatürk University Animal Experiments Local Ethics Committee (HADYEK, Decision No: 2024/13/299).

Bittencourt LO, Chemelo VS, Aragao WAB, Puty B, Dionizio A, Teixeira FB, Fernandes MS, Silva MCF, Fernandes LMP, de Oliveira EHC, Buzalaf MAR, Crespo-Lopez ME, Maia C, Lima RR (2021) From Molecules to Behavior in Long-Term Inorganic Mercury Intoxication: Unraveling Proteomic Features in Cerebellar Neurodegeneration of Rats. Int J Mol Sci 23(1)
Cariccio VL, Sama A, Bramanti P, Mazzon E (2019) Mercury Involvement in Neuronal Damage and in Neurodegenerative Diseases. Biol Trace Elem Res 187(2):341–356
Tripathi S, Kharkwal G, Mishra R, Singh G (2024) Nuclear factor erythroid 2-related factor 2 (Nrf2) signaling in heavy metals-induced oxidative stress, Heliyon
Simsek H, Gur C, Kucukler S, Ileriturk M, Akaras N, Oz M, Kandemir FM (2024) Carvacrol Reduces Mercuric Chloride-Induced Testicular Toxicity by Regulating Oxidative Stress, Inflammation, Apoptosis, Autophagy, and Histopathological Changes. Biol Trace Elem Res 202(10):4605–4617
Zahed MA, Ebrahimi M, Barmakhshad N, Shemshadi S, Parsasharif N (2024) Mercury-mediated neurological diseases: insight into molecular mechanisms, mutant proteins, and structure-based therapeutic inhibitors. Toxicol Environ Health Sci 16(4):459–480
Enogieru AB, Olisah EC (2024) Upregulation of caspase-3, oxidative stress, neurobehavioural and histological alterations in mercury chloride-exposed rats: role of aqueous Allium sativum bulb extract. J Mol Histol 56(1):20
Huang CF, Liu SH, Hsu CJ, Lin-Shiau SY (2011) Neurotoxicological effects of low-dose methylmercury and mercuric chloride in developing offspring mice. Toxicol Lett 201(3):196–204
Yahyazadeh A, Gur FM (2024) Promising the potential of β-caryophyllene on mercury chloride–induced alteration in cerebellum and spinal cord of young Wistar albino rats. Naunyn Schmiedebergs Arch Pharmacol 397(12):10175–10189
Venkatesan RS, Sadiq AMM (2017) Effect of morin-5′-sulfonic acid sodium salt on the expression of apoptosis related proteins caspase 3, Bax and Bcl 2 due to the mercury induced oxidative stress in albino rats. Biomed Pharmacotherapy 85:202–208
Kandemir FM, Ileriturk M, Gur C (2022) Rutin protects rat liver and kidney from sodium valproate-induce damage by attenuating oxidative stress, ER stress, inflammation, apoptosis and autophagy. Mol Biol Rep 49(7):6063–6074
Zhai T, Wang B, Shi C, Zhang C, Shen J, Feng X, Gao F, Yang Y, Jia K, Zhao L (2025) The interplay between endoplasmic reticulum stress and ferroptosis in neurological diseases. Neurochem Res 50(2):99
Kucukler S, Caglayan C, Ozdemir S, Comakli S, Kandemir FM (2024) Hesperidin counteracts chlorpyrifos-induced neurotoxicity by regulating oxidative stress, inflammation, and apoptosis in rats. Metab Brain Dis 39(4):509–522
Kusi M, Becer E, Vatansever HS (2025) Basic approach on the protective effects of hesperidin and naringin in Alzheimer's disease. Nutr Neurosci 28(5):550–562
Caglayan C, Kandemir FM, Darendelioğlu E, Yıldırım S, Kucukler S, Dortbudak MB (2019) Rutin ameliorates mercuric chloride-induced hepatotoxicity in rats via interfering with oxidative stress, inflammation and apoptosis. J Trace Elem Med Biology 56:60–68
Selvaraj P, Pugalendi KV (2010) Hesperidin, a flavanone glycoside, on lipid peroxidation and antioxidant status in experimental myocardial ischemic rats. Redox Rep 15(5):217–223
Bolat I, Yildirim S, Saglam YS, Comakli S, Teki̇n S, Bolat M, Dogan T, Ki̇li̇cli̇oglu M (2025) Gozegi̇r, beta-Caryophyllene attenuates cadmium induced neurotoxicity in rats by modulating different cellular signaling pathways. Neurotoxicology 108:206–217
Bolat M, Bolat I, Tekin S (2025) T. YILMAZ, Mechanistic Insights into the Mitigating Role of Beta-Caryophyllene on Cadmium-Induced Liver Injury, Kafkas Üniversitesi. Veteriner Fakültesi Dergisi 31(4)
Bolat İ, Gözegi̇r B, Çomakli S, Sağlam YS, Çinar B, Teki̇n S, Bolat M, Orhan B (2025) Determination of the effects of syringic acid against cadmium-induced oxidative stress, ER stress, inflammation and apoptosis in kidney tissue of rats by in silico and in vivo methods. Tissue Cell Biochem Biophys 103051
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25(4):402–408
Jomova K, Alomar SY, Nepovimova E, Kuca K, Valko M (2025) Heavy metals: toxicity and human health effects. Arch Toxicol 99(1):153–209
Teixeira FB, de Oliveira ACA, Leao LKR, Fagundes NCF, Fernandes RM, Fernandes LMP, da Silva MCF, Amado LL, Sagica FES, de Oliveira EHC, Crespo-Lopez ME, Maia CSF, Lima RR (2018) Exposure to Inorganic Mercury Causes Oxidative Stress, Cell Death, and Functional Deficits in the Motor Cortex. Front Mol Neurosci 11:125
Rahman MA, Khatun MT, Mim AK, Khandocar MP, Rahman A, Hasan MH, Shimki AI, Hossain MS, Shoily MSA, Faraque A, Amin MF, Ferdous R, Islam MS (2025) Oxidative Stress in DNA Damage and Neurodegenerative Diseases. Unveiling The Mechanisms and Therapeutic Opportunities, Cell Biochem Biophys
Singh A, Tiwari V, Roy S (2025) Multifaceted role of oxidative stress in neurological disorders. Mol Biol Rep 52(1):640
Bodienkova G, Boklazhenko E (2024) Patterns of Changes in Certain Neurospecific Proteins in Patients with Chronic Mercury Intoxication in Post-Contact Period. Neurochemical J 18(1):197–200
de Paula Arrifano G, Crespo-Lopez ME, Lopes-Araujo A, Santos-Sacramento L, Barthelemy JL, de Nazare CGL, Freitas LGR (2023) Augusto-Oliveira, Neurotoxicity and the Global Worst Pollutants: Astroglial Involvement in Arsenic, Lead, and Mercury Intoxication. Neurochem Res 48(4):1047–1065
Akaras N, Simsek H, Ileriturk M, Kucukler S, Gur C, Kandemir FM (2025) Carvacrol mitigates Mercury chloride induced neurotoxicity by regulation of NRF-2/HO-1/NF-kappaB expression. J Trace Elem Med Biol 91:127715
Eciroglu-Sarban H, Altin-Celik P, Kelicen-Ugur P, Donmez-Altuntas H (2025) Neuroprotective Effects of Hesperidin and CK2 Inhibitor DRB on Abeta(1–42)-Induced Neurotoxicity in Differentiated SH-SY5Y Cells. Mol Neurobiol 62(10):12722–12735
Khezri S, Azizian S, Salimi A (2024) Pre-mating exposure with hesperidin protects N-ethyl-N-nitrosourea-induced neurotoxicity and congenital abnormalities in next generation of mice as a model of glioma. J Mol Histol 55(4):627–636
Pyrzynska K (2022) Hesperidin: A Review on Extraction Methods, Stability and Biological Activities. Nutrients 14(12)
Küçükler S, Caglayan C, Özdemir S, Çomaklı S, Kandemir FM (2024) Hesperidin counteracts chlorpyrifos-induced neurotoxicity by regulating oxidative stress, inflammation, and apoptosis in rats. Metab Brain Dis 39(4):509–522
Gautam P, Singh V, Kanwar N, Shri R, Singh T, Singh M, Singh TG, Grewal AK, Kumar A, Singh R, Ahmad SF (2025) Al-Mazroua, Hesperidin mitigates lead-induced neurotoxicity via TFEB-dependent restoration of mitochondrial function, oxidative balance, and neuroinflammation in rats. Neurotoxicology 111:103310
Noshy PA, Azouz RA (2021) Neuroprotective effect of hesperidin against emamectin benzoate-induced neurobehavioral toxicity in rats. Neurotoxicol Teratol 86:106981
Owumi S, Otunla M, Akindipe P, Oluwawibe B, Babalola JO, Chimezie J, Arunsi U, Owoeye O, Oyelere AK (2025) Thymoquinone modulates oxidative stress and inflammation, correcting mercury-induced HO-1/NRF/Trx pathway disruption in experimental rat hepatorenal system: an in vivo and in silico study, BioMetals 1–24
Choi YH (2024) Hesperidin protects C2C12 myoblasts from oxidative damage by reducing ROS-mediated mitochondrial damage and endoplasmic reticulum stress. Mol Cell Toxicol 21(1):251–261
Kumar R, Khan MI, Mabkhoot MEMB, Ashfaq F, Rizvi SI (2024) Hesperidin Protects from High-Fat Diet-induced Oxidative Stress in Experimental Hyperlipidemic Wistar Rats. Natl Acad Sci Lett 47(6):629–632
Wang D, Liao Y, He T (2025) miR-143-3p mediates mercury chloride-induced neurotoxicity by targeting LMO4 and the Akt/GSK3β/mTOR pathway in vitro. Toxicol Res
Deiab NS, Kodous AS, Mahfouz MK, Said AM, Ghobashy MM, Abozaid OAR (2024) Smart Hesperidin/Chitosan Nanogel Mitigates Apoptosis and Endoplasmic Reticulum Stress in Fluoride and Aluminum-Induced Testicular Injury. Biol Trace Elem Res 202(9):4106–4124
Li Q, Feng Y, Wang R, Liu R, Ba Y, Huang H (2023) Recent insights into autophagy and metals/nanoparticles exposure. Toxicol Res 39(3):355–372
Said ES, Ahmed RM, Mohammed RA, Morsi EM, Elmahdi MH, Elsayed HS, Mahmoud RH, Nadwa EH (2021) Ameliorating effect of melatonin on mercuric chloride-induced neurotoxicity in rats. Heliyon 7(7)
Bolat M, Laçin BB, Çelebi F (2024) Investigation of the effects of hesperidin on bisphenol-a induced neurotoxicity in rats. Veterinary Sci Practices 19(1):17–24
Yıldız MO, Çelik H, Caglayan C, Kandemir FM, Gür C, Bayav I, Genç A, Kandemir Ö (2022) Neuromodulatory effects of hesperidin against sodium fluoride-induced neurotoxicity in rats: Involvement of neuroinflammation, endoplasmic reticulum stress, apoptosis and autophagy. Neurotoxicology 90:197–204
Li X, Huang W, Tan R, Xu C, Chen X, Li S, Liu Y, Qiu H, Cao H, Cheng Q (2023) The benefits of hesperidin in central nervous system disorders, based on the neuroprotective effect. Biomed Pharmacother 159:114222
Gao PC, Wang AQ, Chen XW, Cui H, Li Y, Fan RF (2023) Selenium alleviates endoplasmic reticulum calcium depletion-induced endoplasmic reticulum stress and apoptosis in chicken myocardium after mercuric chloride exposure. Environ Sci Pollut Res Int 30(18):51531–51541
Ma Y, Shi Y, Wang Y, Wu Q, Cheng B, Li Y, Wang Z, Chai X, Ren A, Li G (2022) Role of Endoplasmic Reticulum Stress in Nano-Selenium Alleviating Prehierarchical Follicular Atresia Induced by Mercury in Laying Hens. Biol Trace Elem Res 200(12):5205–5217
Demircan N, Ozgur R, Turkan I, Uzilday B (2024) Heavy metal toxicity leads to accumulation of insoluble proteins and induces endoplasmic reticulum stress-specific unfolded protein response in Arabidopsis thaliana. Environ Sci Pollut Res Int 31(40):53206–53218
Rana SVS (2020) Endoplasmic Reticulum Stress Induced by Toxic Elements-a Review of Recent Developments. Biol Trace Elem Res 196(1):10–19
Mehmood AH, Ullah F, Dong B, Liu H (2024) Reaction-based small-molecule fluorescent probes for endoplasmic reticulum- and mitochondria-targeted biosensing and bioimaging. Sci China Mater 67(11):3491–3530
Das S, Murumulla L, Ghosh P, Challa S (2025) Heavy metal-induced disruption of the autophagy-lysosomal pathway: implications for aging and neurodegenerative disorders. Biometals 38(2):371–417
Sarmah D, Nirala A, Hazarika H (2025) Heavy metal-induced neurotoxicity and endocrine disruption from e-waste: emerging health challenges and intervention strategies, Toxicology and Environmental Health Sciences
Kahkesh HH, Badavi M, Dianat M, Nejaddehbashi F, Amini N, Hoseinynejad K (2025) Hesperidin provides dose-dependent renal protection from cisplatin-induced injury, mediated by its regulation of Beclin-1 and LC3-II, Naunyn-Schmiedeberg's Archives of Pharmacology 1–8
Varışlı B, Darendelioğlu E, Caglayan C, Kandemir FM, Ayna A, Genç A, Kandemir Ö (2022) Hesperidin attenuates oxidative stress, inflammation, apoptosis, and cardiac dysfunction in sodium fluoride-Induced cardiotoxicity in rats. Cardiovasc Toxicol 22(8):727–735

No competing interests reported.

Download PDF

Editorial decision: Revision requested
27 Dec, 2025
Reviews received at journal
26 Dec, 2025
Reviewers agreed at journal
15 Dec, 2025
Reviews received at journal
14 Dec, 2025
Reviewers agreed at journal
05 Dec, 2025
Reviewers invited by journal
04 Dec, 2025
Editor assigned by journal
01 Dec, 2025
Submission checks completed at journal
01 Dec, 2025
First submitted to journal
28 Nov, 2025

You are reading this latest preprint version

Hesperidin Attenuates Mercury Chloride-Induced Neurotoxicity in Rats by Modulating Oxidative Stress, Neuroinflammation, Apoptosis, Autophagy and ER Stress

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Chemicals

Groups and Experimental Procedure

Behavioral Tests

Open Field Test (OFT)

Elevated Plus Maze (EPM)

Tissue Collection

Biochemical Analyses

Histopathological Examinations

Immunohistochemical Examinations

Immunofluorescence Examinations

Western Blot Analyses

qRT-PCR Analyses

Statistical Analysis

Results

Effects of Hesperidin on Behavioral Outcomes in Mercury Chloride-Induced Neurotoxicity

Elevated Plus Maze Test

Locomotor Activity Test

Histopathological Findings

Immunohistochemical and Immunofluorescence Findings

Protective Effect of Hesperidin Against HgCl₂-Induced Endoplasmic Reticulum Stress

Effects of Hesperidin on HgCl₂-Induced Autophagic Response (Beclin-1, LC3A, LC3B) at the mRNA Expression Level

Discussion

Conclusion

Declarations

Funding

Competing Interests

Data availability

Ethics Approval

References

Additional Declarations

Status:

Version 1