Bidirectional Upregulation of Klotho by Triiodothyronine and Baicalein: Mitigating Chronic Kidney Disease and Associated Complications in Aged BALB/c Mice

doi:10.21203/rs.3.rs-6306864/v1

Download PDF

Research Article

Bidirectional Upregulation of Klotho by Triiodothyronine and Baicalein: Mitigating Chronic Kidney Disease and Associated Complications in Aged BALB/c Mice

https://doi.org/10.21203/rs.3.rs-6306864/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Chronic kidney disease (CKD) is a global health challenge marked by progressive renal decline and increased mortality. The interplay between CKD and hypothyroidism, particularly nonthyroidal low-triiodothyronine (T3) syndrome, exacerbates disease progression, driven by HPT axis dysfunction and reduced Klotho levels due to the Wnt/β-catenin pathway activation. This study explored Klotho as a link between CKD and hypothyroidism using an adenine-induced CKD aged mouse model. Exogenous T3 and baicalein (BAI), targeting the Wnt pathway, were used to upregulate Klotho expression. Combined T3 and BAI treatment significantly increased Klotho levels, surpassing individual effects, and suppressed key signaling molecules (TGF, NFκB, GSK3), mitigating renal fibrosis and CKD complications, including cardiovascular disorders and dyslipidemia. This bidirectional approach, enhancing Klotho via T3 and sustained Wnt pathway inhibition, offers a novel and effective strategy for CKD management, particularly in elderly patients with hypothyroidism.

Chronic kidney disease

Triiodothyronine

Klotho

Wnt/β-catenin

Aging

Baicalein

The prevalence of chronic kidney disease (CKD) has accelerated worldwide and is becoming a severe health problem [1]. Recent studies suggest that an abnormal increase in CKD, especially in developing Asian countries, is associated with hypertension, type 2 diabetes, and cardiovascular disease (CVD) [2]. The increasing CKD trend can be correlated with the aging population in the last several decades. Consistent with this concept, many studies suggest that aging is an independent risk factor for the development and progression of CKD [3, 4]. Many reports also indicate that CKD is associated with numerous complications, including dyslipidemia, CVD, mineral bone disorder, and thyroid dysfunction [5]. The kidney plays an essential role in thyroid hormone metabolism, degradation, and excretion [6]. Reduced expression of both triiodothyronine (T3) and thyroxine (T4) with elevated levels of thyroid-stimulating hormone (TSH) is commonly observed in CKD patients because of dysregulation of the hypothalamus‒pituitary‒thyroid (HPT) axis [7].

Klotho is a single-pass transmembrane protein detectable in limited tissues, particularly in distal convoluted tubules of the kidneys and the choroid plexus in the brain. The Klotho protein may regulate the occurrence of age-related disorders or natural aging processes by functioning as a circulating humoral factor [8]. The Klotho protein is approximately 130 kDa (1,014 amino acids) with a presumed signal sequence at the N-terminus, a single transmembrane domain at the C-terminus, and a short cytoplasmic domain (10 amino acids) [9, 10]. Membrane Klotho is proteolytically cleaved and shed by different types of secretases, such as α, β, and γ secretases [11–13]. There is also a small secreted form of Klotho produced by alternative splicing consisting of 550 amino acids, a truncated Klotho protein [14]. Clinical studies have suggested that both the membrane and secreted forms of Klotho are downregulated in human CKD, demonstrating that the loss of Klotho is correlated with the pathogenesis of kidney injury [15, 16].

Building upon this foundation, recent investigations have sought to elucidate the mechanistic link between CKD and hypothyroidism through the lens of Klotho biology. Notably, our prior studies revealed that T3, a thyroid hormone, could increase Klotho expression in Caenorhabditis elegans (C. elegans).[17] This raises intriguing questions about the potential benefits of T3 supplementation in mitigating the impaired HPT axis and conferring protective effects against age-associated CKD, particularly in higher mammalian models.

Moreover, many studies reported the over activation of the Wnt/β-catenin pathway in kidney disease including CKD. This overactivation also leads to kidny fibrosis by diposition of ESM. [18–23]. Overactivation of the Wnt pathway in kidney diseases also downregulates Klotho expression [24]. In contrast, Klotho can protect against CKD by inhibiting the Wnt pathway [25–27].

Furthermore, in our prior study involving the nematode C. elegans, we discovered a significant association: suppression of the Wnt pathway leads to increased Klotho expression [28]. Building on these observations, our previous research revealed that T3 can notably augment various forms of kidney-specific Klotho protein while reducing the increase in Wnt/β-catenin pathway activity in aged mice [29]. This reciprocal regulatory mechanism prompts inquiries into its evolutionary conservation across species and potential implications for chronic kidney disease. To supress the inhibition of Klotho by the Wnt/β-catenin pathway in CKD, we chosed a natural compound baicalein (BAI) which is known to inhibits the Wnt/β-catenin pathway. [30–33]. Moreover, preliminary studies from our laboratory using the nematode C. elegans revealed that BAI could increase Klotho expression by inhibiting Wnt ligands [28].

Hence, we assume that stabilizing Klotho expression in CKD kidney may be benificial and can be used as a theraputic approach for CKD patients.So we proposes a novel bidirectional targeting approach that leverages both exogenous hormone (T3) and the natural compound BAI to achieve stable upregulation of Klotho. The rationale behind this dual intervention is grounded in the potential synergistic effects of hormonal and natural compound interventions, aiming for enhanced protective effects against CKD.

Animal care and treatment

Animal studies were performed after approval by the Institutional Animal Ethics Committee (IAEC) of Pondicherry University, India (IAEC approval ref. No: PU/CAHF/23rd IAEC/2019/03, dated 15.04.2019). All the experiments were conducted in accordance with the guidelines of the Committee for the Control and Supervision of Experiments on Animals (CPCSEA), New Delhi, India, under the supervision of the IAEC. The animals were housed under conventional conditions: 23⁰ ± 2⁰ C, 12:12 light:dark cycle, standard diet, and water ad libitum. Twenty-month-old BALB/c mice were used for this study. After 15 days of acclimatization, the animals were grouped, with six animals in each group, on the basis of their weight. Blood collection and euthanasia of the animals were carried out under isoflurane narcosis. All experimental animals were approved in advance by the Institutional Animal Ethics Committee (IAEC). CKD was induced by the addition of 50 mg/kg b.w. adenine (Sigma Aldrich, USA) dissolved in 0.5% carboxy methyl cellulose (CMC) via an oral dose for 21 days, whereas the control animals received 0.5% CMC for only 21 days Add reference [34]. After CKD induction, the animals were further divided into different groups. The CKD group received a vehicle for T3 and BAI (0.1 N NaOH and DMSO) and was named the placebo group. The other groups received an individual dose of either 1 mg/kg b.w. T3 or 75 mg/kg b.w. Baicalein (BAI) (Sigma Aldrich, USA) was administered after treatment. The T3 and BAI doses were fixed based on previous reports [35–39]. However, the supraphysiologic dose of T3 has been chosen to monitor its physiological effect on Klotho protein expression in the kidney. The last group received the combined treatment (T3 + BAI group). BAI was administered for five consecutive days after 21 days, whereas T3 was administered during the last three days, i.e., the 24th–26th days. All the animal experiments used in the manuscript followed the recommendations of the ARRIVE guidelines. The experimental design is outlined in Fig. 1.

Serum and urine biochemical parameters

Serum creatinine, urea, blood urea nitrogen (BUN), albumin, calcium, inorganic phosphorus, hemoglobin, total cholesterol (TC), total triglyceride (TG), high-density lipoprotein (HDL-C), alkaline phosphatase (ALP) activity, bilirubin, urine creatinine, and urea were measured via the Agappe diagnostic kit (Agappe Diagnostic, India) according to the manufacturer’s instructions. LDL-C and VLDL-C were calculated via the equation provided by Sampson et al. [40] as follows:

$$\:\text{LDL-C}=\frac{TC}{0.948}-\frac{\text{HDL-C}}{0.971}-\left(\frac{TG}{8.56}-\frac{TG\times\:\text{Non-HDL-C}}{2140}-\frac{{TG}^{2}}{16100}-9.44\right)$$

$$\:\text{VLDL-C}=\frac{TG}{8.59}+\frac{TG\times\:\text{Non-HDL-C}}{2250}-\frac{{TG}^{2}}{16500}$$

ELISA

T3 (E-EL-0079), TSH (E-EL-M1153), and 1,25 hydroxy Vit-D3 (E-EL-0016) ELISA kits were purchased from Elabscience USA. T3 and Vit-D3 levels were measured via competitive ELISA, and TSH levels were measured via the sandwich ELISA method according to the manufacturer’s instructions.

Histological analysis

Kidney tissue was harvested and fixed in 10% neutral buffered formalin, and a 4-µm-thick section was prepared from paraffin-embedded tissue with the help of an expert histopathologist. The kidney sections were further stained with H&E and Masson’s trichrome. Kidney damage was evaluated on the basis of parameters such as inflammatory infiltration, protein casts, interstitial fibrosis, and ECM deposition. The parameters were measured in ten randomly selected fields from each section at 400x magnification. All the parameters were measured via ImageJ software.

RNA isolation and qRT‒PCR analysis

RNA express reagent (Hi-Media, India) was used to isolate total RNA from mouse kidney tissue. Briefly, 2 µg of RNA was subjected to cDNA synthesis via a cDNA isolation kit (Thermo Fisher Scientific, USA) per the manufacturer’s instructions. cDNA was subjected to qPCR using SYBR green master mix (Roche, USA). The qPCR was run on a Hi-Media Insta Q48™ real-time machine for 40 cycles. mRNA was quantified via the 2^−ΔΔCt method, with β-actin used as an internal control [41]. The details of the primers used are listed in Table 1.

Western blotting analysis

For western blot analysis, all reagents were purchased from Sigma Aldrich, USA, unless otherwise indicated. Kidney tissue was homogenized in RIPA lysis buffer supplemented with protease and phosphatase inhibitors. Equal concentrations of proteins were loaded and electrophoresed on a 10% gradient tris-glycine gel. Proteins were electrophoretically transferred to an immobile-P PVDF membrane (Roche, USA). After being blocked with 5% nonfat skim milk for 1 h at room temperature, the membranes were incubated with primary antibodies (Santacruz, USA) against anti-Klotho (sc-515942), anti-GSK3β (sc-7291), anti-β-catenin (sc-7963), anti-CK1 (sc-74582), anti-NFκB (sc-8008), anti-IL6 (sc-57315) and anti-GAPDH (sc-32233) at 4°C overnight. After thorough washing with buffers, the membranes were incubated with a secondary antibody (sc-516102) for 1 h at room temperature. The bands were then developed in a chemiluminescence substrate via the Vilber Chemi Doc imaging system. The intensity of each band was measured via ImageJ software, and the relative expression was determined with respect to that of GAPDH.

Antioxidant enzyme assay

Catalase assay

Catalase activity was measured as described previously [42]. The tissue homogenate was incubated in the substrate at 37°C for three minutes. After incubation, the reaction was stopped with ammonium molybdate. The absorbance of the molybdate and hydrogen peroxide yellow complex was measured at 374 nm against a blank. The specific activity was expressed as U/mg of protein.

SOD activity

SOD activity in the tissue homogenate was measured via the methods of Kostyuk V A et al. [43]. SOD activity was measured by the inhibition of autooxidation of quercetin by the enzyme at pH 10. The results are expressed as U/mg of protein.

Statistical analysis

Two-way analysis of variance with post hoc Tukey correction was used to compare the means of different groups. All experiments were performed in triplicate, and the results are reported as the means ± SEMs. The graphs were plotted via GraphPad Prism software (GraphPad Software, San Diego, CA, USA), and statistical significance was also measured via the same software. The error bars represent the SEM. p values < 0.05 were considered statistically significant.

CKD reduces body weight and improves with bidirectional treatment

The body weights of all the animals were measured every two days during the treatment period. The body weights of the animals significantly decreased during the adenine administration period. At the adenine diet endpoint (21st day), the adenine-fed placebo group animals weighed 31% less than the control group did (p < 0.001). In contrast, when adenine-fed animals were treated with T3, BAI, or the combined dose (T3 + BAI) alone, significant improvements in body weight at the end of the treatments (27th day) were observed. The T3-treated animals presented an increase in body weight of 17.9% (p < 0.001), the BAI-treated animals presented an increase of 16.6% (p < 0.001), and the combined (T3 + BAI)-treated animals presented the greatest increase of 19.2% (p < 0.001) from the 27th-day placebo group body weight (Fig. 2).

Bidirectional treatment ameliorates abnormal serum and urine parameters in CKD animals

The present study of adenine-induced CKD in aged animals assessed kidney injury via serum and biochemical kidney injury markers. We initially observed that the serum creatinine, urea, and BUN concentrations were significantly greater in the placebo group than in the control group. The percentage of increase in creatinine was 8.8-fold (p < 0.001), that in urea was 1.56-fold (p < 0.05), and that in BUN was 1.56-fold (p < 0.05). In contrast, the urine creatinine and urea concentrations in the placebo group were significantly lower than those in the control group (3.12-fold (p < 0.01) and 2.08-fold (p < 0.01), respectively). Moreover, the urine ALB concentration increased 3.05-fold (p < 0.001) in the placebo group than in the control group, leading to significant albuminuria. However, treatment with either T3, BAI or their combination (T3 + BAI) ameliorated the changes observed in the placebo group toward the normal range. Specifically, in comparison with the treated groups, the combined (T3 + BAI) treatment produced a more pronounced effect, in which the serum creatinine, urea and BUN levels were 3.8-fold (p < 0.01), 1.63-fold, (p < 0.01), and 1.68-fold (p < 0.001) lower, respectively, than those in the placebo group. (Table 2)

Effects of T3, BAI, and the combined treatment (T3 + BAI) on kidney fibrosis and extracellular matrix deposition in CKD animals

Kidney sections were subjected to H&E and Masson’s trichrome staining to assess pathological renal conditions (Fig. 3). H&E staining (Fig. 3a) revealed that CKD mice in the placebo group presented significant monocyte and lymphocyte infiltration (A), protein casts (B), and cytoplasmic vacuolation (C) in renal sections. Moreover, the Masson’s trichrome-stained (Fig. 3b) renal sections indicate an increase in interstitial fibrosis with a high deposition of extracellular matrix components in the placebo group. However, treatment with T3, BAI or their combination (T3 + BAI) significantly improved the damage. The damage to the renal sections was evaluated on the basis of ten randomly selected fields per section, which were examined at 400x magnification. The evaluation criteria and observed results are presented in Table 3. Overall, our results showed that the combined treatment produced a better counteractive effect on renal fibrosis and ECM accumulation.

Combined treatment (T3 + BAI) maximally counteracts the decline in kidney Klotho levels during CKD

Recent evidence has shown that Klotho can serve not only as an early biomarker of CKD but also as a potential therapeutic target for CKD [44, 45]. In our study of adenine-induced CKD, we found that the mRNA expression of M-Klotho and Sp-Klotho was significantly lower in the placebo group than in the control group by 3.25-fold (p < 0.001) and 2.35-fold (p < 0.001), respectively (Fig. 4a, c). In contrast, M-Klotho expression increased significantly in the T3, BAI, and combined (T3 + BAI) groups by 4.5-fold (p < 0.001), 3.6-fold (p < 0.01), and 5.5-fold (p < 0.001), respectively, compared with that in the placebo group (Fig. 4b). Similarly, Sp-Klotho expression also increased significantly upon T3, BAI, and combined (T3 + BAI) treatment by 4.2-fold (p < 0.001), 2.4-fold (p < 0.05), and 5.3-fold (p < 0.001), respectively (Fig. 4d). The protein expression of Klotho revealed that α-KL and SKL expression was markedly lower in the placebo-treated group than in the control group (91.6% and 15.5%, respectively) (Fig. 4e, f, g). Upon treatment with T3 and BAI, a significant increase in Klotho protein expression was observed, and the combined treatment (T3 + BAI) resulted in greater Klotho protein expression than either of the individual treatments did.

Aberrant increase in GSK-3β expression during CKD is maximally suppressed by T3 + BAI

Recent studies have also implicated GSK3β in diverse kidney diseases, and targeting GSK3β improved kidney fibrosis [46, 47]. To address this issue, we evaluated the expression of GSK-3β, which tends to be overexpressed in different types of kidney injury. We found a significant 3.3-fold (p < 0.001) increase in GSK-3β protein expression in the kidneys of the adenine-fed placebo group compared with the control group. Interestingly, compared with the placebo, the T3 and BAI treatments counteracted the observed changes in expression by 2.1-fold (p < 0.001) and 1.8-fold (p < 0.01), respectively. The optimal downregulation of GSK3β, with a decrease of 4.6-fold (p < 0.001), was observed in the combined (T3 + BAI)-treated group (Fig. 5a, b).

Combined treatment (T3 + BAI) suppresses the canonical Wnt/β-catenin pathway in CKD animals

Understanding the crosstalk of the evolutionarily conserved Wnt/β-catenin pathway with other signaling pathways is crucial for understanding kidney disease progression and elucidating the therapeutic potential of treatment protocols [48]. To determine the effects of our treatments on the canonical Wnt/β-catenin pathway, the mRNA expression of Wnt ligands such as Wnt1, 3, 8A, 8B, and 10A and the protein expression of β-catenin and casein kinase 1 (CK-1) were measured. We found that the mRNA expression of all Wnt ligands increased significantly in the placebo-treated mice compared with the control mice (Fig. 6a). However, treatment with BAI alone or in combination (T3 + BAI) repressed the expression of these mRNAs compared with that in the placebo group (Fig. 6b). In contrast, no significant (p < 0.99) changes were observed in the group that received only the T3 treatment.

At the level of β-catenin protein expression, we observed a significant increase of 97.9% (p < 0.001), and CK-1 expression was 38.5% (p < 0.01) lower in the placebo group than in the control group. In contrast, after the T3 and BAI treatments, the protein expression of β-catenin decreased significantly [T3: 27.6% (p < 0.01); BAI: 17.8% (p < 0.01)], and CK-1 [T3: 58.5% (p < 0.01); BAI: 50.4% (p < 0.01)] increased significantly toward a normal level. Moreover, the combined treatment group exhibited a maximum decrease in β-catenin [58.3% (p < 0.01)] with increasing CK-1 [71% (p < 0.01)] protein expression compared with the placebo group. (Fig. 6c, d, e).

Treatments can modulate kidney TGF-β expression

Regarding the genesis of CKD, the role of TGF-β as an essential mediator of the whole process has been recognized recently [49]. In the present study, we found that the expression of TGF-β mRNA increased significantly, by 4.1-fold (p < 0.001), in the placebo group compared with the control group (Fig. 7a). Upon treatment with either T3 and/or BAI, a significant reduction in TGF-β mRNA expression of 2.3-fold (p < 0.05) and 2.6-fold (p < 0.05) was observed compared with that in the placebo group. In comparison, the combined (T3 + BAI) group presented a 3.56-fold greater reduction in TGF-β mRNA expression (p < 0.05) than the placebo group did (Fig. 7b).

Protective effect against CKD-induced inflammation

A proinflammatory state is also linked to chronic kidney disease, and persistent low-grade inflammation is increasingly recognized as a defining feature of CKD [50, 51]. Increased production and decreased clearance of proinflammatory cytokines contribute to the chronic inflammatory status in CKD [52, 53]. Thus, we analyzed the expression of cytokines and inflammatory immune cell accumulation in the kidneys to assess the intensity of renal inflammation.

The protein expression levels of inflammatory kidney markers, such as nuclear factor-κB (NF-κB) and interleukin 6 (IL-6), were significantly greater in the placebo-treated mice than in the control mice. This includes increases in NF-κB by 2.7-fold (p ≤ 0.001) and in IL-6 by 3-fold (p ≤ 0.001). Moreover, the T3 and BAI groups presented significantly lower levels of inflammatory markers than did the placebo group. Moreover, compared with the placebo treatment, the individual T3 and BAI treatments significantly reduced N-FκB expression by 2.2-fold (p ≤ 0.01) and 1.8-fold (p ≤ 0.01), respectively. Similarly, compared with the placebo, T3 and BAI significantly reduced IL-6 expression by 1.5-fold (p ≤ 0.01) and 1.65-fold (p ≤ 0.01), respectively. The maximum reduction in inflammatory markers was observed in the combined treatment group, in which NF-κB expression was reduced by 4.3-fold (p ≤ 0.001) and IL-6 expression was reduced by 3-fold (p ≤ 0.001) compared with those in the placebo group (Fig. 8a, b, c). These findings provide evidence that combined T3 + BAI could alter the increase in inflammatory cytokines during CKD, thereby protecting the kidneys from further deterioration.

T3 but not BAI could protect CKD animals from anemia

A decrease in one or more important red blood cell parameters, such as the hematocrit, hemoglobin concentration, or red blood cell count, is referred to as anemia. Since anemia is a frequent side effect of CKD, it is unquestionably an independent risk factor for worse outcomes in CKD patients. Anemia is less common in early kidney disease, and it often worsens as kidney disease progresses and when more kidney function is lost [54, 55]. Hence, we were interested in determining the anemia status in CKD mice and the effect of treatment on anemia status. The hematocrit percentage and hemoglobin concentration were significantly lower in the placebo group than in the control group by 27.4% (p ≤ 0.05) and 23.3% (p ≤ 0.05), respectively. Compared with those in the placebo group, the hematocrit percentages in the T3- and combined (T3 + BAI)-treated groups were 17.08% (p ≤ 0.05) and 15.7% (p ≤ 0.05), respectively. Similarly, the Hb concentration increased by 14.7% (p ≤ 0.05) and 14.7% (p ≤ 0.05), respectively. In contrast, no significant changes were observed in the BAI-treated group (p ≤ 0.48). We can conclude that only T3 could protect animals from CKD-induced anemia (Table 4).

T3 but not BAI modulates mineral bone disorders in CKD

CKD-induced mineral bone disorders include abnormalities in bone and mineral composition [56]. CKD patients develop an inadequate 1,25-dihydroxyvitamin D level, predisposing them to hyperphosphatemia. Furthermore, both processes together cause a reduced serum calcium level [5]. As a result of bone wear and tear, the serum alkaline phosphatase (ALP) level is increased in CKD patients [57–59]. Hence, serum phosphate, calcium, vitamin D3, and alkaline phosphatase (ALP) activities were estimated to investigate the potential of treatments for modulating mineral and bone disorders. Our results revealed a significant increase in the serum phosphate concentration and a decrease in the calcium concentration in the placebo-treated mice compared with those in the control mice (Table 5).

Moreover, these changes in Ca and Pi levels during CKD were reversed toward their normal range by the T3 and BAI treatments, with maximum reversal caused by the combined treatment. Similarly, an increase in the mRNA expression of the phosphate channel NPT2a, followed by a decrease in the expression of the calcium channel TRPV5, was detected in CKD animals. However, the combined treatment had a much greater positive effect on the altered changes caused by CKD, reversing the abnormality through decreased NPT2a and increased TRPV5 mRNA expression (Fig. 9). Compared with those in control mice, a significant decrease in serum vitamin D3 levels and an increase in alkaline phosphatase (ALP) activity were also observed in placebo-treated mice, indicating bone wear and tear. However, these abnormal changes were counteracted by T3 and combined (T3 + BAI) treatment. No significant differences were observed in the BAI-treated group (p ≤ 0.34) (Table 5).

Protective effect on CKD-associated cardiovascular risk

End-stage renal disease (ESRD) is widely known to increase cardiovascular risk, and it is estimated that dialysis patients have cardiovascular death rates that are ten to one hundred times greater than those in the general population [60]. A heightened proinflammatory microenvironment and other modifying factors (dyslipidemia) during CKD predispose individuals to cardiovascular events (Supplementary Result S3). The atherogenic index (AI) and coronary risk index (CRI), which are calculated on the basis of serum triglyceride, total cholesterol (TC) and high-density lipoprotein cholesterol (HDL-C) levels (Supplementary Table 1), were significantly greater (p ≤ 0.001) in the placebo group than in the control group (Fig. 10a, b). The risk levels pertaining to the AI and CRI were lower in the T3- and BAI-treated animals than in the placebo-treated animals. Compared with either of the individual treatments, the combined treatment was better at lowering the AI and CRI predispositions.

Like kidney tissue, heart tissue was also checked for damage via H&E staining of thin sections. We found that in the placebo group, there was a significant increase in fibrosis and inflammatory infiltration compared with those in the control group. Surprisingly, individual T3 and BAI treatments reduced fibrosis, and T3 had a greater antifibrotic effect than BAI did. Moreover, the combined treatment (T3 + BAI) produced a significantly more pronounced antifibrotic effect than either of the individual treatments did (Fig. 10c, d). Like those in the kidney, a similar trend of antioxidant enzyme activities in the heart tissue was observed, wherein SOD and catalase activities were significantly reduced in the placebo-treated mice (p ≤ 0.001). In contrast, T3 and BAI alleviated the activity of both enzymes, and compared with the placebo, the combined treatment (T3 + BAI) resulted in the highest activity of both enzymes.

In the present study, we aimed to decipher the protective effect of combined T3 and BAI treatment on adenine-induced CKD in old mice. As per our previous findings [17, 61], we intend to bidirectionally target CKD using the thyroid hormones T3 and BAI. T3 was used with the intention of maintaining a normal HPT axis in CKD, whereas BAI was used to counteract the exaggerated upregulation of the Wnt/β-catenin pathway, as previously reported. Interestingly, we found that both treatments could enhance Klotho via different targets. Furthermore, as CKD predisposes individuals to other complications, such as anemia, dyslipidemia, cardiovascular disease, and mineral bone disorders, we intend to evaluate the therapeutic potential of individual (either T3 or BAI) versus combined (T3 + BAI) treatment for these complications.

Serum and urine biomarkers, including creatinine, urea, BUN, and albumin, are used as standard clinical indices to assess kidney disorders leading to CKD [51, 62–64]. The adenine oral dose significantly impaired kidney function, as evidenced by increased serum creatinine, urea, BUN, and urine albumin levels, followed by decreased urinary excretion of creatine and urea. In this study, when CKD mice were treated with T3, BAI, or their combination (T3 + BAI), all the abnormal serum parameters reverted toward their normal range, indicating that there were improvements in kidney function after the treatments.

Research indicates that CKD significantly impacts the HPT axis, impairing thyroid hormone metabolism [5, 65, 66]. Subclinical hypothyroidism prevalence rises with decreasing GFR and advancing age, often accompanied by lower serum T3 and T4 levels and higher TSH levels [7]. Our findings align with these reports, showing reduced T3 and elevated TSH in CKD mice (Supplementary Results S1).

To address HPT axis dysregulation, exogenous T3 was administered at a previously reported dose [35, 36]. After 12 hours of treatment, TSH levels significantly decreased in the T3 and T3 + BAI groups, while no notable changes occurred in BAI-only animals due to T3's biological half-life. Further studies are needed to refine the dosage and timing of thyroid hormone therapy, given the study's limitations in pharmacokinetic analyses in CKD models.

Glomerulosclerosis, interstitial fibrosis, and tubular atrophy are symptoms of renal fibrosis resulting from the inability of kidney tissue to be repaired after long-term, chronic damage [67]. Renal cells are replaced by ECM in the glomeruli and interstitium as CKD progresses, which is accompanied by the loss of renal cells [68, 69]. Morphological analysis of CKD kidneys using H&E and Masson’s trichrome staining revealed increased inflammatory infiltration, protein casts, and ECM deposition following adenine treatment. However, T3 and BAI combination therapy significantly reduced fibrosis and ECM deposition, demonstrating a protective effect against further deterioration in aged CKD mice.

Klotho is primarily expressed on the cell surface of DCT and PCT in the kidney and is maintained at normal levels under physiological conditions [70–74]. However, CKD leads to reduced Klotho levels, evident in both nephritic dysfunction and animal models. CKD decreases mRNA expression of M-Kl and Sp-Kl and reduces α-Kl and S-Kl protein levels [75, 76].

T3 and BAI treatments restored Klotho mRNA and protein expression toward normal, with the combination treatment showing the greatest effect. BAI likely increases Klotho by inhibiting the Wnt/β-catenin pathway, while T3 directly activates Klotho, as suggested by previous findings.

The standard progression route for CKDs, including renal tubulointerstitial fibrosis, often leads to ESRD. Recent findings highlight GSK3β's role in renal tubular cell profibrogenic plasticity during CKD progression, particularly through its interaction with pathways like TGF-β1 signaling [46]. Elevated GSK-3β expression in glomeruli and renal tubular cells is linked to kidney diseases like proteinuric glomerulopathies and podocyte damage [77–79]. Determining changes in GSK3β expression after treatment is essential. CKD kidneys show elevated GSK-3β levels, indicating tubular inflammation and damage. While individual treatments with T3 and BAI downregulated GSK-3β, they did not significantly reduce fibrosis. In contrast, combined therapy markedly reduced GSK-3β expression, likely by stabilizing Klotho expression. T3 enhances Klotho levels, while BAI reduces its transcriptional inhibition by β-catenin, as Klotho downregulates GSK-3β expression [80].

The canonical Wnt/β-catenin pathway, an evolutionarily conserved signaling pathway, controls the pathogenesis of many diseases. Overexpression of this pathway has been observed in different types of kidney injury [81–84]. Sustained activation of the canonical Wnt/β-catenin pathway drives acute kidney injury (AKI) to CKD progression [85]. Adenine-fed animals displayed enhanced activation of the Wnt/β-catenin pathway, as evidenced by increased mRNA expression of various Wnt ligands, reduced CK-1 protein levels, and elevated β-catenin protein production in the kidney. The natural compound BAI effectively suppressed the elevated mRNA expression of all Wnt ligands in CKD mice. Moreover, T3 and BAI effectively restored β-catenin and CK-1 expression levels in CKD mice, with the combination therapy further promoting β-catenin degradation. We propose that T3’s inhibitory effect on the Wnt pathway may be mediated through its ability to upregulate Klotho expression, as Klotho can inhibit the Wnt/β-catenin pathway without directly affecting Wnt ligand mRNA expression. (Add t3 Klotho paper) [86–88]. Similarly, since the highest levels of Klotho expression were observed with the combined T3 and BAI treatment, we speculate that BAI’s inhibition of the Wnt/β-catenin pathway may prevent this major upregulated pathway, observed in CKD, from suppressing Klotho expression. This mechanism likely ensures the sustained upregulation of Klotho protein in the kidney, contributing to its pronounced beneficial effects.

TGF-β is a key profibrotic regulator in CKD, promoting ECM accumulation, preventing its breakdown, and activating myofibroblasts [89–92]. Therapeutic strategies targeting TGF-β in experimental and clinical CKD models have shown reduced renal fibrosis and injury [93, 94]. Studies in renal epithelial cells reveal that Klotho inhibition increases TGF-β1 expression, while TGF-β1 suppresses Klotho, indicating that reduced Klotho promotes TGF-β1 activity, creating a cycle contributing to renal fibrosis in CKD [95]. In this study, adenine-induced CKD mice showed increased TGF-β mRNA expression, linked to activation of the Wnt/β-catenin pathway and reduced Klotho expression. However, the combination treatment group exhibited a significant reduction in TGF-β levels. These findings align with previous reports [96], suggesting that Klotho inhibits TGF-β signaling, offering potential benefits in suppressing renal fibrosis.

Fibrosis in CKD is closely associated with increased inflammation, characterized by elevated levels of inflammatory cytokines such as NF-κB, TNF-α, and interleukins in adenine-induced CKD mice. Klotho, as an anti-inflammatory regulator, can mitigate NF-κB activity by reducing proinflammatory gene transcription [97]. Consistently, our study observed a marked increase in NF-κB and IL-6 protein expression in the kidneys of CKD mice. We hypothesize that our dual treatment strategy may counteract inflammation by enhancing Klotho expression. Notably, the anti-inflammatory effects of T3 and BAI were most pronounced in the combination therapy (T3 + BAI) group, potentially attributable to the significant upregulation of Klotho expression induced by the combined treatment.

CKD is marked by oxidative stress due to reduced antioxidant activity and excessive ROS production [98], with a strong link between ROS generation and Klotho levels. Klotho mitigates oxidative stress by downregulating insulin/IGF-1/PI3K signaling, activating FoxO, and inducing MnSOD formation [99]. Additionally, free radicals (e.g., H2O2, O2•–) are generated during hypoxanthine/xanthine conversion to uric acid via xanthine oxidase (XO) [100–102]. Adenine-induced overproduction of hypoxanthine elevates XO expression, causing oxidative damage in CKD kidneys [103]. To evaluate the kidney's antioxidant defense, we measured catalase and SOD activity. As anticipated, adenine-induced CKD kidneys showed reduced expression of these antioxidant enzymes. All treatment groups effectively restored their altered activity levels. (Supplementary Results S2).

CKD is associated with various complications, including anemia, mineral and bone disorders, dyslipidemia, and cardiovascular conditions. We investigated whether our dual treatment offers protection solely against CKD or also mitigates these associated complications. Notably, the combined treatment demonstrated protective effects against all the aforementioned CKD-related complications.

In the case of CKD-induced anemia, which arises from mechanisms such as reduced erythropoietin synthesis, hypothyroidism, and shortened red blood cell lifespan [5, 104], the protective effect was mediated by T3 but not by BAI. This can be attributed to T3's well-established role in stimulating erythropoiesis [105–107].

To examine its effect on mineral and bone disorders, we measured phosphate (Pi) and calcium (Ca²⁺) levels, commonly altered in CKD (increased Pi and decreased Ca²⁺ levels) [15]. Since Klotho regulates phosphate and calcium homeostasis, our combined treatment normalized these levels via the actions of both T3 and BAI. This was further supported by increased mRNA expression of kidney phosphate and calcium channels regulated by Klotho. Mineral and bone disorders in CKD are also driven by elevated alkaline phosphatase (ALP) activity and reduced vitamin D3 levelsv [108].. These abnormalities were corrected by T3, highlighting its additional protective role. Thus, T3 and BAI function through distinct mechanisms to address CKD-induced anemia and mineral and bone disorders.

CKD is a systemic condition often accompanied by dyslipidemia. As renal function declines, hyperlipidemia becomes more common, with elevated LDL cholesterol and triglyceride levels correlating with the severity of impairmen [5]. Furthermore, dyslipidemia and elevated serum TSH levels are independent risk factors for cardiovascular diseases [109, 110].

The bidirectional treatment effectively reversed the altered lipid profile and protected against dyslipidemia (Supplementary Results S3). To evaluate its protective effect on CVD, we initially assessed coronary disease risk using lipid profile markers by calculating the Atherogenic Index (AI) and Cardiac Risk Index (CRI). CKD mice showed a higher CVD risk, which decreased with T3 and BAI treatments, with the combined treatment providing the greatest reduction.

Given the elevated CVD risk in CKD mice, we examined heart tissue for fibrosis using H&E staining. Notably, CKD hearts displayed significant fibrosis. Similar to findings in the kidney, combined treatment offered superior protection in the heart compared to individual therapies, as evidenced by reduced fibrotic areas, highlighting its protective role against CVD.

Increased oxidative stress in the kidney prompted an evaluation of antioxidant enzyme activity in heart tissue. Both catalase and SOD activities were diminished in CKD mice but improved with treatment, demonstrating the protective effects of Klotho in cardiac tissue as well.

This study identified a novel therapeutic approach for CKD treatment using the endogenous hormone T3 and the natural compound BAI. Both agents stabilize Klotho protein in CKD kidneys through distinct pathways. The reduced Klotho expression in CKD results from decreased T3 levels and activation of the Wnt/β-catenin pathway. This combined therapy shows potential for greater efficacy, particularly in older patients with subclinical hypothyroidism.

Triiodothyronine

BAI

Baicalein

M-Kl

Membrane Klotho

S-Kl

Soluble Klotho

Sp-Kl

Spliced Klotho

α-Kl

Alpha Klotho

Wnt

Wingless-related integration site

Atherogenic index

BUN

Blood urea nitrogen

CKD

Chronic kidney disease

CVD

Cardiovascular disease

GSK-3β

Glycogen synthase kinase 3 beta

TRPC6

Transient receptor potential cation channel

TRPV5

Transient receptor potential cation channel subfamily V member 5

TGF-β

Transforming growth factor-beta

Total cholesterol

Triglyceride

LDL

Low-density lipoprotein

V-LDL

Very low-density lipoprotein.

Disclosure

All the authors declare that they have no competing interests and have consented to the submission of this manuscript.

Ethics approval: Approved by the Institutional Animal Ethics Committee (IAEC) of Pondicherry University, India (IAEC approval ref. No: PU/CAHF/23rd IAEC/2019/03, dated 15.04.2019

Acknowledgments

The authors acknowledge the Department of Biochemistry and Molecular Biology, Pondicherry University, India, and the Department of Science & Technology “Fund for Improvement of S&T Infrastructure”, (DST-FIST), Science and Engineering Research Board (SERB), Government of India, for financial and overall support.

Credit authorship contribution statement

Saswat Kumar Mohanty: Conceptualization, methodology, investigation, formal analysis, writing - original draft, project administration

Vikas kumar Sahu, Bhanu Pratap Singh: Helped SKM in conducting investigations as a part of their M.Sc. dissertation.

Kitlangki Suchiang: Supervision, conceptualization, validation, formal analysis, review and editing, funding acquisition

Funding

This work was supported by the Department of Biochemistry and Molecular Biology, Pondicherry University, India, and SERB, New Delhi (File No EEQ/2022/000514). SKM was supported by a fellowship from the Council of Scientific and Industrial Research (CSIR) (File no 09/559(0128)/2019-EMR-I), Ministry of Science and Technology, Government of India.

Data availability

The datasets generated and/or analyzed in this study are available from the corresponding author Kitlangki Suchiang upon reasonable request.

A.C. McClellan, L. Plantinga, W.M. McClellan, Epidemiology, geography and chronic kidney disease, Curr Opin Nephrol Hypertens 21 (2012) 323–328. https://doi.org/10.1097/MNH.0B013E3283521DAE.
Y. Tsukamoto, H. Wang, G. Becker, H.C. Chen, D.S. Han, D. Harris, E. Imai, V. Jha, P.K.T. Li, E.J.C. Lee, S. Matsuo, Y. Tomino, K. Tungsanga, K. Yamagata, A. Hishida, Report of the Asian Forum of Chronic Kidney Disease Initiative (AFCKDI) 2007. “Current status and perspective of CKD in Asia”: diversity and specificity among Asian countries, Clin Exp Nephrol 13 (2009) 249–256. https://doi.org/10.1007/S10157-009-0156-8.
N. Perico, G. Remuzzi, A. Benigni, Aging and the kidney, Curr Opin Nephrol Hypertens 20 (2011) 312–317. https://doi.org/10.1097/MNH.0B013E328344C327.
D. Choudhury, M. Levi, Kidney aging--inevitable or preventable?, Nat Rev Nephrol 7 (2011) 706–717. https://doi.org/10.1038/NRNEPH.2011.104.
R. Thomas, A. Kanso, J.R. Sedor, Chronic kidney disease and its complications, Prim Care 35 (2008) 329–344. https://doi.org/10.1016/J.POP.2008.01.008.
S. Khatiwada, K.C. Rajendra, S. Gautam, M. Lamsal, N. Baral, Thyroid dysfunction and dyslipidemia in chronic kidney disease patients, BMC Endocr Disord 15 (2015) 1–7. https://doi.org/10.1186/S12902-015-0063-9/TABLES/3.
I. van Hoek, S. Daminet, Interactions between thyroid and kidney function in pathological conditions of these organ systems: a review, Gen Comp Endocrinol 160 (2009) 205–215. https://doi.org/10.1016/J.YGCEN.2008.12.008.
Y. Takahashi, M. Kuro-O, F. Ishikawa, Aging mechanisms., Proc Natl Acad Sci U S A 97 (2000) 12407–8. https://doi.org/10.1073/pnas.210382097.
Y. Nabeshima, H. Imura, alpha-Klotho: a regulator that integrates calcium homeostasis., Am J Nephrol 28 (2008) 455–64. https://doi.org/10.1159/000112824.
Y. Nabeshima, The discovery of α-Klotho and FGF23 unveiled new insight into calcium and phosphate homeostasis, Cellular and Molecular Life Sciences 65 (2008) 3218–3230. https://doi.org/10.1007/s00018-008-8177-0.
L. Bloch, O. Sineshchekova, D. Reichenbach, K. Reiss, P. Saftig, M. Kuro-o, C. Kaether, Klotho is a substrate for α-, β- and γ-secretase, FEBS Lett 583 (2009) 3221–3224. https://doi.org/10.1016/J.FEBSLET.2009.09.009.
C.-D. Chen, S. Podvin, E. Gillespie, S.E. Leeman, C.R. Abraham, Insulin stimulates the cleavage and release of the extracellular domain of Klotho by ADAM10 and ADAM17, Proceedings of the National Academy of Sciences 104 (2007) 19796–19801. https://doi.org/10.1073/pnas.0709805104.
C.-D. Chen, T.Y. Tung, J. Liang, E. Zeldich, T.B. Tucker Zhou, B.E. Turk, C.R. Abraham, Identification of Cleavage Sites Leading to the Shed Form of the Anti-Aging Protein Klotho, Biochemistry 53 (2014) 5579–5587. https://doi.org/10.1021/bi500409n.
Y. Matsumura, H. Aizawa, T. Shiraki-Iida, R. Nagai, M. Kuro-o, Y. Nabeshima, Identification of the HumanKlothoGene and Its Two Transcripts Encoding Membrane and SecretedKlothoProtein, Biochem Biophys Res Commun 242 (1998) 626–630. https://doi.org/10.1006/BBRC.1997.8019.
M.C. Hu, M. Shi, J. Zhang, H. Quiñones, C. Griffith, M. Kuro-o, O.W. Moe, Klotho Deficiency Causes Vascular Calcification in Chronic Kidney Disease, Journal of the American Society of Nephrology 22 (2011) 124–136. https://doi.org/10.1681/ASN.2009121311.
N. Koh, T. Fujimori, S. Nishiguchi, A. Tamori, S. Shiomi, T. Nakatani, K. Sugimura, T. Kishimoto, S. Kinoshita, T. Kuroki, Y. ichi Nabeshima, Severely reduced production of klotho in human chronic renal failure kidney, Biochem Biophys Res Commun 280 (2001) 1015–1020. https://doi.org/10.1006/BBRC.2000.4226.
S.K. Mohanty, K. Suchiang, Triiodothyronine (T3) enhances lifespan and protects against oxidative stress via activation of Klotho in Caenorhabditis elegans, Biogerontology 22 (2021) 397–413. https://doi.org/10.1007/S10522-021-09923-0.
K. Surendran, S. Schiavi, K.A. Hruska, Wnt-Dependent β-Catenin Signaling Is Activated after Unilateral Ureteral Obstruction, and Recombinant Secreted Frizzled-Related Protein 4 Alters the Progression of Renal Fibrosis, Journal of the American Society of Nephrology 16 (2005) 2373–2384. https://doi.org/10.1681/ASN.2004110949.
P.J. Nelson, C. Von Toerne, H.J. Gröne, Wnt-signaling pathways in progressive renal fibrosis, Expert Opin Ther Targets 15 (2011) 1073–1083. https://doi.org/10.1517/14728222.2011.588210.
D.M. Iglesias, P.A. Hueber, L.L. Chu, R. Campbell, A.M. Patenaude, A.J. Dziarmaga, J. Quinlan, O. Mohamed, D. Dufort, P.R. Goodyer, Canonical WNT signaling during kidney development, Am J Physiol Renal Physiol 293 (2007). https://doi.org/10.1152/ajprenal.00416.2006.
W. He, R.J. Tan, Y. Li, D. Wang, J. Nie, F.F. Hou, Y. Liu, Matrix metalloproteinase-7 as a surrogate marker predicts renal Wnt/β-catenin activity in CKD, Journal of the American Society of Nephrology 23 (2012) 294–304. https://doi.org/10.1681/ASN.2011050490/-/DCSUPPLEMENTAL.
A. Boutet, C.A. De Frutos, P.H. Maxwell, M.J. Mayol, J. Romero, M.A. Nieto, Snail activation disrupts tissue homeostasis and induces fibrosis in the adult kidney, EMBO J 25 (2006) 5603–5613. https://doi.org/10.1038/SJ.EMBOJ.7601421.
C. Dai, D.B. Stolz, L.P. Kiss, S.P. Monga, L.B. Holzman, Y. Liu, Wnt/β-Catenin Signaling Promotes Podocyte Dysfunction and Albuminuria, Journal of the American Society of Nephrology 20 (2009) 1997–2008. https://doi.org/10.1681/ASN.2009010019.
J.R. Muñoz‐Castañeda, C. Herencia, M.V. Pendón‐Ruiz de Mier, M.E. Rodriguez‐Ortiz, J.M. Diaz‐Tocados, N. Vergara, J.M. Martínez‐Moreno, M.D. Salmerón, W.G. Richards, A. Felsenfeld, M. Kuro‐O, Y. Almadén, M. Rodríguez, Differential regulation of renal Klotho and FGFR1 in normal and uremic rats, The FASEB Journal 31 (2017) 3858–3867. https://doi.org/10.1096/fj.201700006R.
X. Bi, K. Yang, B. Zhang, J. Zhao, The Protective Role of Klotho in CKD-Associated Cardiovascular Disease, (2020). https://doi.org/10.1159/000509369.
W. He, Y.S. Kang, C. Dai, Y. Liu, Blockade of Wnt/β-Catenin Signaling by Paricalcitol Ameliorates Proteinuria and Kidney Injury, Journal of the American Society of Nephrology 22 (2011) 90–103. https://doi.org/10.1681/ASN.2009121236.
K. Surendran, S. Schiavi, K.A. Hruska, Wnt-Dependent β-Catenin Signaling Is Activated after Unilateral Ureteral Obstruction, and Recombinant Secreted Frizzled-Related Protein 4 Alters the Progression of Renal Fibrosis, Journal of the American Society of Nephrology 16 (2005) 2373–2384. https://doi.org/10.1681/ASN.2004110949.
S.K. Mohanty, K. Suchiang, Baicalein mitigates oxidative stress and enhances lifespan through modulation of Wnt ligands and GATA factor: ELT-3 in Caenorhabditis elegans, Life Sci (2023) 121946. https://doi.org/10.1016/J.LFS.2023.121946.
S.K. Mohanty, A.K. Mohanty, M.S. Kumar, K. Suchiang, Triiodothyronine enhances various forms of kidney-specific Klotho protein and suppresses the Wnt/β-catenin pathway: Insights from in-vitro, in-vivo and in-silico investigations, Cell Signal 120 (2024) 111214. https://doi.org/10.1016/J.CELLSIG.2024.111214.
C. Dai, S. Tang, Y. Wang, T. Velkov, X. Xiao, Baicalein acts as a nephroprotectant that ameliorates colistin-induced nephrotoxicity by activating the antioxidant defence mechanism of the kidneys and down-regulating the inflammatory response, Journal of Antimicrobial Chemotherapy 72 (2017) 2562–2569. https://doi.org/10.1093/jac/dkx185.
D. Liu, L. Chen, H. Zhao, N.D. Vaziri, S.C. Ma, Y.Y. Zhao, Small molecules from natural products targeting the Wnt/β-catenin pathway as a therapeutic strategy, Biomedicine and Pharmacotherapy 117 (2019) 108990. https://doi.org/10.1016/j.biopha.2019.108990.
E. Örenlili Yaylagül, C. Ülger, The effect of baicalein on Wnt/β-catenin pathway and miR-25 expression in Saos-2 osteosarcoma cell line, Turk J Med Sci 50 (2020) 1168–1179. https://doi.org/10.3906/sag-2001-161.
X. Xia, J. Xia, H. Yang, Y. Li, S. Liu, Y. Cao, L. Tang, X. Yu, Baicalein blocked cervical carcinoma cell proliferation by targeting CCND1 via Wnt/β-catenin signaling pathway, Artif Cells Nanomed Biotechnol 47 (2019) 2729–2736. https://doi.org/10.1080/21691401.2019.1636055.
A. Rahman, D. Yamazaki, A. Sufiun, K. Kitada, H. Hitomi, D. Nakano, A. Nishiyama, A novel approach to adenine-induced chronic kidney disease associated anemia in rodents, PLoS One 13 (2018). https://doi.org/10.1371/JOURNAL.PONE.0192531.
R. Vargas, B. Riquelme, J. Fernández, L.A. Videla, A combined docosahexaenoic acid–thyroid hormone protocol upregulates rat liver β-Klotho expression and downstream components of FGF21 signaling as a potential novel approach to metabolic stress conditions, Food Funct 8 (2017) 3980–3988. https://doi.org/10.1039/C7FO00923B.
A.C. Adams, I. Astapova, F.M. Fisher, M.K. Badman, K.E. Kurgansky, J.S. Flier, A.N. Hollenberg, E. Maratos-Flier, Thyroid hormone regulates hepatic expression of fibroblast growth factor 21 in a PPARalpha-dependent manner, J Biol Chem 285 (2010) 14078–14082. https://doi.org/10.1074/JBC.C110.107375.
D. Li, G. Shi, J. Wang, D. Zhang, Y. Pan, H. Dou, Y. Hou, Baicalein ameliorates pristane-induced lupus nephritis via activating Nrf2/HO-1 in myeloid-derived suppressor cells, Arthritis Res Ther 21 (2019) 1–14. https://doi.org/10.1186/S13075-019-1876-0/FIGURES/7.
S.W. Kuo, W.L. Su, T.C. Chou, Baicalin improves the survival in endotoxic mice and inhibits the inflammatory responses in LPS-treated RAW 264.7 macrophages, Eur J Inflamm 18 (2020). https://doi.org/10.1177/2058739220967767.
K. Wang, C. Feng, C. Li, J. Yao, X. Xie, L. Gong, Y. Luan, G. Xing, X. Zhu, X. Qi, J. Ren, Baicalin Protects Mice from Aristolochic Acid I-Induced Kidney Injury by Induction of CYP1A through the Aromatic Hydrocarbon Receptor, International Journal of Molecular Sciences 2015, Vol. 16, Pages 16454-16468 16 (2015) 16454–16468. https://doi.org/10.3390/IJMS160716454.
M. Sampson, C. Ling, Q. Sun, R. Harb, M. Ashmaig, R. Warnick, A. Sethi, J.K. Fleming, J.D. Otvos, J.W. Meeusen, S.R. Delaney, A.S. Jaffe, R. Shamburek, M. Amar, A.T. Remaley, A New Equation for Calculation of Low-Density Lipoprotein Cholesterol in Patients With Normolipidemia and/or Hypertriglyceridemia, JAMA Cardiol 5 (2020) 540–548. https://doi.org/10.1001/JAMACARDIO.2020.0013.
K.J. Livak, T.D. Schmittgen, Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method, Methods 25 (2001) 402–408. https://doi.org/10.1006/METH.2001.1262.
M.H. Hadwan, H.N. Abed, Data supporting the spectrophotometric method for the estimation of catalase activity, Data Brief 6 (2016) 194–199. https://doi.org/10.1016/j.dib.2015.12.012.
A.I.P. Vladmir A. Kostyuk, Superoxide-driven oxidation of quercetin and a simple sensitive assay for determination of superoxide dismutase, Biochem Int 19 (1989) 1117–1124.
M.C. Hu, M. Kuro-o, O.W. Moe, Renal and extrarenal actions of Klotho, Semin Nephrol 33 (2013) 118–129. https://doi.org/10.1016/J.SEMNEPHROL.2012.12.013.
J.A. Neyra, M.C. Hu, Potential application of klotho in human chronic kidney disease, Bone 100 (2017) 41–49. https://doi.org/10.1016/J.BONE.2017.01.017.
B. Chen, P. Wang, X. Liang, C. Jiang, Y. Ge, L.D. Dworkin, R. Gong, Permissive effect of GSK3β on profibrogenic plasticity of renal tubular cells in progressive chronic kidney disease, Cell Death Dis 12 (2021) 1–14. https://doi.org/10.1038/s41419-021-03709-5.
S. Zhou, P. Wang, Y. Qiao, Y. Ge, Y. Wang, S. Quan, R. Yao, S. Zhuang, L.J. Wang, Y. Du, Z. Liu, R. Gong, Genetic and Pharmacologic Targeting of Glycogen Synthase Kinase 3β Reinforces the Nrf2 Antioxidant Defense against Podocytopathy, J Am Soc Nephrol 27 (2016) 2289–2308. https://doi.org/10.1681/ASN.2015050565.
S.S. Li, Q. Sun, M.R. Hua, P. Suo, J.R. Chen, X.Y. Yu, Y.Y. Zhao, Targeting the Wnt/β-Catenin Signaling Pathway as a Potential Therapeutic Strategy in Renal Tubulointerstitial Fibrosis, Front Pharmacol 12 (2021) 2112. https://doi.org/10.3389/fphar.2021.719880.
F.J. López-Hernández, J.M. López-Novoa, Role of TGF-β in chronic kidney disease: an integration of tubular, glomerular and vascular effects, Cell Tissue Res 347 (2012) 141–154. https://doi.org/10.1007/S00441-011-1275-6.
S. de Frutos, A. Luengo, A. García-Jérez, M. Hatem-Vaquero, M. Griera, F. O’Valle, M. Rodríguez–Puyol, D. Rodríguez–Puyol, L. Calleros, Chronic kidney disease induced by an adenine rich diet upregulates integrin linked kinase (ILK) and its depletion prevents the disease progression, Biochim Biophys Acta Mol Basis Dis 1865 (2019) 1284–1297. https://doi.org/10.1016/j.bbadis.2019.01.024.
B.H. Ali, M. Alza’abi, A. Ramkumar, I. Al-Lawati, M.I. Waly, S. Beegam, A. Nemmar, S. Brand, N. Schupp, The effect of activated charcoal on adenine-induced chronic renal failure in rats, Food and Chemical Toxicology 65 (2014) 321–328. https://doi.org/10.1016/J.FCT.2013.12.038.
S.F. Rapa, B.R. Di Iorio, P. Campiglia, A. Heidland, S. Marzocco, Inflammation and Oxidative Stress in Chronic Kidney Disease—Potential Therapeutic Role of Minerals, Vitamins and Plant-Derived Metabolites, Int J Mol Sci 21 (2020). https://doi.org/10.3390/IJMS21010263.
O.M. Akchurin, F. Kaskel, Update on inflammation in chronic kidney disease, Blood Purif 39 (2015) 84–92. https://doi.org/10.1159/000368940.
J.L. Babitt, H.Y. Lin, Mechanisms of anemia in CKD, Journal of the American Society of Nephrology 23 (2012) 1631–1634. https://doi.org/10.1681/ASN.2011111078.
J. Portolés, L. Martín, J.J. Broseta, A. Cases, Anemia in Chronic Kidney Disease: From Pathophysiology and Current Treatments, to Future Agents, Front Med (Lausanne) 8 (2021) 328. https://doi.org/10.3389/fmed.2021.642296.
S. Moe, T. Drüeke, J. Cunningham, W. Goodman, K. Martin, K. Olgaard, S. Ott, S. Sprague, N. Lameire, G. Eknoyan, Definition, evaluation, and classification of renal osteodystrophy: a position statement from Kidney Disease: Improving Global Outcomes (KDIGO), Kidney Int 69 (2006) 1945–1953. https://doi.org/10.1038/SJ.KI.5000414.
D.L. Regidor, C.P. Kovesdy, R. Mehrotra, M. Rambod, J. Jing, C.J. McAllister, D. Van Wyck, J.D. Kopple, K. Kalantar-Zadeh, Serum alkaline phosphatase predicts mortality among maintenance hemodialysis patients, J Am Soc Nephrol 19 (2008) 2193–2203. https://doi.org/10.1681/ASN.2008010014.
P.U. Torres, Bone alkaline phosphatase isoforms in chronic renal failure, Kidney Int 61 (2002) 1178–1179. https://doi.org/10.1046/J.1523-1755.2002.00241-1.X.
P. Magnusson, C.A. Sharp, M. Magnusson, J. Risteli, M.W.J. Davie, L. Larsson, Effect of chronic renal failure on bone turnover and bone alkaline phosphatase isoforms, Kidney Int 60 (2001) 257–265. https://doi.org/10.1046/J.1523-1755.2001.00794.X.
R.N. Foley, P.S. Parfrey, M.J. Sarnak, Clinical epidemiology of cardiovascular disease in chronic renal disease, American Journal of Kidney Diseases 32 (1998). https://doi.org/10.1053/ajkd.1998.v32.pm9820470.
S.K. Mohanty, K. Suchiang, Baicalein mitigates oxidative stress and enhances lifespan through modulation of Wnt ligands and GATA factor: ELT-3 in Caenorhabditis elegans, Life Sci 329 (2023) 121946. https://doi.org/10.1016/J.LFS.2023.121946.
L. Nguy, H. Nilsson, J. Lundgren, M.E. Johansson, T. Teerlink, P.G. Scheffer, G. Guron, Vascular function in rats with adenine-induced chronic renal failure, Am J Physiol Regul Integr Comp Physiol 302 (2012). https://doi.org/10.1152/ajpregu.00696.2011.
D. Wu, N. Luo, L. Wang, Z. Zhao, H. Bu, G. Xu, Y. Yan, X. Che, Z. Jiao, T. Zhao, J. Chen, A. Ji, Y. Li, G.D. Lee, Hydrogen sulfide ameliorates chronic renal failure in rats by inhibiting apoptosis and inflammation through ROS/MAPK and NF-κB signaling pathways, Scientific Reports 2017 7:1 7 (2017) 1–16. https://doi.org/10.1038/s41598-017-00557-2.
V. Diwan, L. Brown, G.C. Gobe, Adenine-induced chronic kidney disease in rats, Nephrology 23 (2018) 5–11. https://doi.org/10.1111/NEP.13180.
J. Malyszko, J. Malyszko, S. Wolczynski, M. Mysliwiec, Adiponectin, leptin and thyroid hormones in patients with chronic renal failure and on renal replacement therapy: are they related?, Nephrol Dial Transplant 21 (2006) 145–152. https://doi.org/10.1093/NDT/GFI081.
J.C. Lo, G.M. Chertow, A.S. Go, C.Y. Hsu, Increased prevalence of subclinical and clinical hypothyroidism in persons with chronic kidney disease, Kidney Int 67 (2005) 1047–1052. https://doi.org/10.1111/J.1523-1755.2005.00169.X.
A.C. Webster, E. V. Nagler, R.L. Morton, P. Masson, Chronic Kidney Disease, Lancet 389 (2017) 1238–1252. https://doi.org/10.1016/S0140-6736(16)32064-5.
A. Nogueira, M.J. Pires, P.A. Oliveira, Pathophysiological Mechanisms of Renal Fibrosis: A Review of Animal Models and Therapeutic Strategies, In Vivo 31 (2017) 1–22. https://doi.org/10.21873/INVIVO.11019.
C. Zoccali, R. Vanholder, Z.A. Massy, A. Ortiz, P. Sarafidis, F.W. Dekker, D. Fliser, D. Fouque, G.H. Heine, K.J. Jager, M. Kanbay, F. Mallamaci, G. Parati, P. Rossignol, A. Wiecek, G. London, The systemic nature of CKD, Nature Reviews Nephrology 2017 13:6 13 (2017) 344–358. https://doi.org/10.1038/nrneph.2017.52.
H. Komaba, J. Kaludjerovic, D.Z. Hu, K. Nagano, K. Amano, N. Ide, T. Sato, M.J. Densmore, J. ichi Hanai, H. Olauson, T. Bellido, T.E. Larsson, R. Baron, B. Lanske, Klotho expression in osteocytes regulates bone metabolism and controls bone formation, Kidney Int 92 (2017) 599–611. https://doi.org/10.1016/J.KINT.2017.02.014.
R.G. Erben, O. Andrukhova, FGF23-Klotho signaling axis in the kidney, Bone 100 (2017) 62–68. https://doi.org/10.1016/J.BONE.2016.09.010.
M.C. Hu, M. Shi, J. Zhang, J. Pastor, T. Nakatani, B. Lanske, M.S. Razzaque, K.P. Rosenblatt, M.G. Baum, M. Kuro‐O, O.W. Moe, Klotho: a novel phosphaturic substance acting as an autocrine enzyme in the renal proximal tubule, FASEB J 24 (2010) 3438–3450. https://doi.org/10.1096/FJ.10-154765.
M. Kuro-o, Y. Matsumura, H. Aizawa, H. Kawaguchi, T. Suga, T. Utsugi, Y. Ohyama, M. Kurabayashi, T. Kaname, E. Kume, H. Iwasaki, A. Iida, T. Shiraki-Iida, S. Nishikawa, R. Nagai, Y.I. Nabeshima, Mutation of the mouse klotho gene leads to a syndrome resembling ageing, Nature 390 (1997) 45–51. https://doi.org/10.1038/36285.
Y. Kato, E. Arakawa, S. Kinoshita, A. Shirai, A. Furuya, K. Yamano, K. Nakamura, A. Iida, H. Anazawa, N. Koh, A. Iwano, A. Imura, T. Fujimori, M. Kuro-O, N. Hanai, K. Takeshige, Y.I. Nabeshima, Establishment of the anti-Klotho monoclonal antibodies and detection of Klotho protein in kidneys, Biochem Biophys Res Commun 267 (2000) 597–602. https://doi.org/10.1006/BBRC.1999.2009.
W.L. Lau, E.M. Leaf, M.C. Hu, M.M. Takeno, M. Kuro-O, O.W. Moe, C.M. Giachelli, Vitamin D receptor agonists increase klotho and osteopontin while decreasing aortic calcification in mice with chronic kidney disease fed a high phosphate diet, Kidney Int 82 (2012) 1261–1270. https://doi.org/10.1038/KI.2012.322.
M.C. Hu, M. Shi, J. Zhang, H. Quiñones, C. Griffith, M. Kuro-o, O.W. Moe, Klotho deficiency causes vascular calcification in chronic kidney disease, J Am Soc Nephrol 22 (2011) 124–136. https://doi.org/10.1681/ASN.2009121311.
R. Gong, Y. Ge, S. Chen, E. Liang, A. Esparza, E. Sabo, A. Yango, R. Gohh, A. Rifai, L.D. Dworkin, Glycogen synthase kinase 3beta: a novel marker and modulator of inflammatory injury in chronic renal allograft disease, Am J Transplant 8 (2008) 1852–1863. https://doi.org/10.1111/J.1600-6143.2008.02319.X.
K.M. Boini, K. Amann, D. Kempe, D.R. Alessi, F. Lang, Proteinuria in mice expressing PKB/SGK-resistant GSK3, Am J Physiol Renal Physiol 296 (2009). https://doi.org/10.1152/ajprenal.90398.2008.
J. Paeng, J.H. Chang, S.H. Lee, B.Y. Nam, H.Y. Kang, S. Kim, H.J. Oh, J.T. Park, S.H. Han, T.H. Yoo, S.W. Kang, Enhanced glycogen synthase kinase-3β activity mediates podocyte apoptosis under diabetic conditions, Apoptosis 19 (2014) 1678–1690. https://doi.org/10.1007/S10495-014-1037-5.
S.K. Mohanty, A.K. Mohanty, M.S. Kumar, K. Suchiang, Triiodothyronine enhances various forms of kidney-specific Klotho protein and suppresses the Wnt/β-catenin pathway: Insights from in-vitro, in-vivo and in-silico investigations, Cell Signal 120 (2024) 111214. https://doi.org/10.1016/J.CELLSIG.2024.111214.
Y. Zuo, Y. Liu, New insights into the role and mechanism of Wnt/β-catenin signalling in kidney fibrosis, Nephrology 23 (2018) 38–43. https://doi.org/10.1111/NEP.13472.
Y. Wang, C.J. Zhou, Y. Liu, Wnt Signaling in Kidney Development and Disease, in: Prog Mol Biol Transl Sci, Academic Press, 2018: pp. 181–207. https://doi.org/10.1016/bs.pmbts.2017.11.019.
R. Nusse, H. Clevers, Wnt/β-Catenin Signaling, Disease, and Emerging Therapeutic Modalities, Cell 169 (2017) 985–999. https://doi.org/10.1016/J.CELL.2017.05.016.
S. Angers, R.T. Moon, Proximal events in Wnt signal transduction, Nature Reviews Molecular Cell Biology 2009 10:7 10 (2009) 468–477. https://doi.org/10.1038/nrm2717.
L. Xiao, D. Zhou, R.J. Tan, H. Fu, L. Zhou, F.F. Hou, Y. Liu, Sustained Activation of Wnt/β-Catenin Signaling Drives AKI to CKD Progression, Journal of the American Society of Nephrology 27 (2016) 1727–1740. https://doi.org/10.1681/ASN.2015040449.
L. Zhou, Y. Li, D. Zhou, R.J. Tan, Y. Liu, Loss of Klotho contributes to kidney injury by derepression of Wnt/β-catenin signaling, Journal of the American Society of Nephrology 24 (2013) 771–785. https://doi.org/10.1681/ASN.2012080865/-/DCSUPPLEMENTAL.
J.R. Muñoz-Castañeda, C. Rodelo-Haad, M.V. Pendon-Ruiz de Mier, A. Martin-Malo, R. Santamaria, M. Rodriguez, Klotho/FGF23 and Wnt Signaling as Important Players in the Comorbidities Associated with Chronic Kidney Disease, Toxins (Basel) 12 (2020). https://doi.org/10.3390/TOXINS12030185.
H. Kadoya, M. Satoh, Y. Nishi, M. Kondo, Y. Wada, Y. Sogawa, K. Kidokoro, H. Nagasu, T. Sasaki, N. Kashihara, Klotho is a novel therapeutic target in peritoneal fibrosis via Wnt signaling inhibition, Nephrol Dial Transplant 35 (2020) 773–781. https://doi.org/10.1093/NDT/GFZ298.
E. Gagliardini, A. Benigni, Role of anti-TGF-beta antibodies in the treatment of renal injury, Cytokine Growth Factor Rev 17 (2006) 89–96. https://doi.org/10.1016/J.CYTOGFR.2005.09.005.
W.A. Border, N.A. Noble, Interactions of Transforming Growth Factor-β and Angiotensin II in Renal Fibrosis, Hypertension 31 (1998) 181–188. https://doi.org/10.1161/01.HYP.31.1.181.
Q. Guan, S. Li, S. Gao, H. Chen, C.Y.C. Nguan, C. Du, Reduction of chronic rejection of renal allografts by anti-transforming growth factor-β antibody therapy in a rat model, Am J Physiol Renal Physiol 305 (2013). https://doi.org/10.1152/AJPRENAL.00665.2012.
F.N. Ziyadeh, B.B. Hoffman, D.C. Han, M.C. Iglesias-De La Cruz, S.W. Hong, M. Isono, S. Chen, T.A. McGowan, K. Sharma, Long-term prevention of renal insufficiency, excess matrix gene expression, and glomerular mesangial matrix expansion by treatment with monoclonal antitransforming growth factor-beta antibody in db/db diabetic mice, Proc Natl Acad Sci U S A 97 (2000) 8015–8020. https://doi.org/10.1073/PNAS.120055097.
D. Zou, W. Wu, Y. He, S. Ma, J. Gao, The role of klotho in chronic kidney disease, BMC Nephrol 19 (2018). https://doi.org/10.1186/S12882-018-1094-Z.
K. Sharma, Y. Jin, J. Guo, F.N. Ziyadeh, Neutralization of TGF-β by Anti-TGF-β Antibody Attenuates Kidney Hypertrophy and the Enhanced Extracellular Matrix Gene Expression in STZ-Induced Diabetic Mice, Diabetes 45 (1996) 522–530. https://doi.org/10.2337/DIAB.45.4.522.
H. Sugiura, T. Yoshida, S. Shiohira, J. Kohei, M. Mitobe, H. Kurosu, M. Kuro-O, K. Nitta, K. Tsuchiya, Reduced Klotho expression level in kidney aggravates renal interstitial fibrosis, Am J Physiol Renal Physiol 302 (2012). https://doi.org/10.1152/AJPRENAL.00294.2011.
S. Doi, Y. Zou, O. Togao, J. V. Pastor, G.B. John, L. Wang, K. Shiizaki, R. Gotschall, S. Schiavi, N. Yorioka, M. Takahashi, D.A. Boothman, M. Kuro-o, Klotho inhibits transforming growth factor-β1 (TGF-β1) signaling and suppresses renal fibrosis and cancer metastasis in mice, Journal of Biological Chemistry 286 (2011) 8655–8665. https://doi.org/10.1074/jbc.M110.174037.
Y. Maekawa, K. Ishikawa, O. Yasuda, R. Oguro, H. Hanasaki, I. Kida, Y. Takemura, M. Ohishi, T. Katsuya, H. Rakugi, Klotho suppresses TNF-alpha-induced expression of adhesion molecules in the endothelium and attenuates NF-kappaB activation, Endocrine 35 (2009) 341–346. https://doi.org/10.1007/S12020-009-9181-3.
V. Ravarotto, F. Simioni, E. Pagnin, P.A. Davis, L.A. Calò, Oxidative stress - chronic kidney disease - cardiovascular disease: A vicious circle, Life Sci 210 (2018) 125–131. https://doi.org/10.1016/J.LFS.2018.08.067.
M. Yamamoto, J.D. Clark, J. V. Pastor, P. Gurnani, A. Nandi, H. Kurosu, M. Miyoshi, Y. Ogawa, D.H. Castrillon, K.P. Rosenblatt, M. Kuro-O, Regulation of oxidative stress by the anti-aging hormone klotho, Journal of Biological Chemistry 280 (2005) 38029–38034. https://doi.org/10.1074/jbc.M509039200.
R. Radi, Oxygen radicals, nitric oxide, and peroxynitrite: Redox pathways in molecular medicine, Proc Natl Acad Sci U S A 115 (2018) 5839–5848. https://doi.org/10.1073/PNAS.1804932115.
E.E. Kelley, N.K.H. Khoo, N.J. Hundley, U.Z. Malik, B.A. Freeman, M.M. Tarpey, Hydrogen peroxide is the major oxidant product of xanthine oxidase, Free Radic Biol Med 48 (2010) 493–498. https://doi.org/10.1016/j.freeradbiomed.2009.11.012.
N. Aziz, R.T. Jamil, Biochemistry, Xanthine Oxidase, StatPearls Publishing, 2021.
A. Mehmood, L. Zhao, M. Ishaq, O.D. Zad, L. Zhao, C. Wang, M. Usman, Y. Lian, M. Xu, Renoprotective effect of stevia residue extract on adenine-induced chronic kidney disease in mice, J Funct Foods 72 (2020) 103983. https://doi.org/10.1016/J.JFF.2020.103983.
F. Nuhu, S. Bhandari, Oxidative stress and cardiovascular complications in chronic kidney disease, the impact of anaemia, Pharmaceuticals 11 (2018). https://doi.org/10.3390/ph11040103.
S. Park, C.R. Han, J.W. Park, L. Zhao, X. Zhu, M. Willingham, D.M. Bodine, S.Y. Cheng, Defective erythropoiesis caused by mutations of the thyroid hormone receptor α gene, PLoS Genet 13 (2017). https://doi.org/10.1371/journal.pgen.1006991.
N. Dainiak, D. Sutter, S. Kreczko, L-Triiodothyronine Augments Erythropoietic Growth Factor Release From Peripheral Blood and Bone Marrow Leukocytes, Blood 68 (1986) 1289–1297. https://doi.org/10.1182/BLOOD.V68.6.1289.1289.
L. Malgor, C. Blanc, E. Klainer, S. Irizar, P. Torales, L. Barrios, Direct Effects of Thyroid Hormones on Bone Marrow Erythroid Cells of Rats, Blood 45 (1975) 671–679. https://doi.org/10.1182/BLOOD.V45.5.671.671.
C.P. Kovesdy, V. Ureche, J.L. Lu, K. Kalantar-Zadeh, Outcome predictability of serum alkaline phosphatase in men with pre-dialysis CKD, Nephrology Dialysis Transplantation 25 (2010) 3003–3011. https://doi.org/10.1093/ndt/gfq144.
L.H. Duntas, L. Wartofsky, Cardiovascular risk and subclinical hypothyroidism: focus on lipids and new emerging risk factors. What is the evidence?, Thyroid 17 (2007) 1075–1084. https://doi.org/10.1089/THY.2007.0116.
S. MacMahon, S. Duffy, A. Rodgers, S. Tominaga, L. Chambless, G. De Backer, D. De Bacquer, M. Kornitzer, P. Whincup, S.G. Wannamethee, R. Morris, N. Wald, J. Morris, M. Law, M. Knuiman, H. Bartholomew, G. Davey Smith, P. Sweetnam, P. Elwood, J. Yarnell, R. Kronmal, D. Kromhout, S. Sutherland, J. Keil, G. Jensen, P. Schnohr, C. Hames, A. Tyroler, A. Aromaa, P. Knekt, A. Reunanen, J. Tuomilehto, P. Jousilahti, E. Vartiainen, P. Puska, T. Kuznetsova, T. Richart, J. Staessen, L. Thijs, T. Jorgensen, T. Thomsen, D. Sharp, J.D. Curb, N. Qizilbash, H. Iso, S. Sato, A. Kitamura, Y. Naito, A. Benetos, L. Guize, U. Goldbourt, M. Tomita, Y. Nishimoto, T. Murayama, M. Criqui, C. Davis, C. Hart, D. Hole, C. Gillis, D. Jacobs, H. Blackburn, R. Luepker, J. Neaton, L. Eberly, C. Cox, D. Levy, R. D’Agostino, H. Silbershatz, A. Tverdal, R. Selmer, T. Meade, K. Garrow, J. Cooper, F. Speizer, M. Stampfer, A. Menotti, A. Spagnolo, I. Tsuji, Y. Imai, T. Ohkubo, S. Hisamichi, L. Haheim, I. Holme, I. Hjermann, P. Leren, P. Ducimetiere, J. Empana, K. Jamrozik, R. Broadhurst, G. Assmann, H. Schulte, C. Bengtsson, C. Björkelund, L. Lissner, P. Sorlie, M. Garcia-Palmieri, E. Barrett-Connor, R. Langer, K. Nakachi, K. Imai, X. Fang, S. Li, R. Buzina, A. Nissinen, C. Aravanis, A. Dontas, A. Kafatos, H. Adachi, H. Toshima, T. Imaizumi, S. Nedeljkovic, M. Ostojic, Z. Chen, H. Tunstall-Pedoe, T. Nakayama, N. Yoshiike, T. Yokoyama, C. Date, H. Tanaka, J. Keller, K. Bonaa, E. Arnesen, E. Rimm, M. Gaziano, J.E. Buring, C. Hennekens, S. Törnberg, J. Carstensen, M. Shipley, D. Leon, M. Marmot, J. Armitage, C. Baigent, R. Clarke, R. Collins, J. Emberson, J. Halsey, M. Landray, S. Lewington, A. Palmer, S. Parish, R. Peto, P. Sherliker, G. Whitlock, Blood cholesterol and vascular mortality by age, sex, and blood pressure: a meta-analysis of individual data from 61 prospective studies with 55 000 vascular deaths, The Lancet 370 (2007) 1829–1839. https://doi.org/10.1016/S0140-6736(07)61778-4.

Table 1. Mouse nucleotide sequences of the primers used for qRT‒PCR analysis
	Primer Sequence 5’ to 3’
Gene	Forward	Reverse
MKL	CAATGGCTTTCCTCCTTTAC	AACACAGGTTTGCGTAGTCT
Sp-KL	CAATGGCTTTCCTCCTTTAC	GACTTCTGTGTTGAATCTTA
NPT2a	AGGTGAGCTCCGCCATTCCGA	CCCTGCAAAAGCCCGCCTGA
TRPV5	CTCCGCCTTCCATCGAAGTTC	GATGTCAGCTCCATGCTCAATG
WNT-1	GCCCTAGCTGCCAACAGTAGT	GAAGATGAACGCTGTTTCTCG
WNT-3	GGGGCGTATTCAAGTAGCTG	GTAGGGACCTCCCATTGGAT
WNT-8A	CTGACTACTGCAACCGCAAC	TGACAGTGCAACACCACTGA
WNT-8B	CCAGAGTTCCGGGAGGTAG	GAGATGGAGCGGAAGGTGT
WNT-10A	GCGCTCCTGTTCTTCCTACT	ATGCCCTGGATAGCAGAGG
TGFβ	CGAAGCGGACTACTATGCTAAA	TCCCGAATGTCTGACGTATTG
Beta Actin	CACACTGTGCCCATCTACG	GCCATCTCTTGCTCGAAGTC

Table 2. Kidney function test: Serum and urine biochemical parameters
	Control	Placebo	T3	BAI	T3 + BAI
Serum Creatinine (mg/dL)	0.263 ± 0.063	2.281 ± 0.093 ^{# # #}	1.281 ± 081 ^✱	1.541 ± 0.040 ^✱✱	0.609 ± 0.034 ^✱✱
Urine Creatinine (mg/dL)	17.34 ± 0.093	5.606 ± 0.393 ^{# #}	11.91 ± 0.343 ^✱✱✱	9.813 ± 0.375 ^✱✱	13.88 ± 0.187 ^✱✱✱
Serum Urea (mg/dL)	54.66 ± 2.241	85.34 ± 2.586 ^#	62.93 ± 2.434 ^✱✱	64.66 ± 1.96 ^✱✱	52.59 ± 2.473 ^✱✱
Urine Urea (mg/dL)	311.2 ± 4.31	150 ± 6.897 ^{# #}	233.6 ± 6.034 ^✱✱	269.8 ± 7.759 ^✱✱✱	306 ± 5.674 ^✱✱✱
BUN (mg/dL)	25.58 ± 1.049	39.94 ± 1.211 ^#	29.45 ± 1.324 ^✱✱	30.26 ± 0.403 ^✱✱	24.61 ± 1.243 ^✱✱
Urine Albumin (g/dL)	35.85 ± 1.887	109.4 ± 3.774 ^{# # #}	52.83 ± 3.656 ^✱✱	62.26 ± 1.887 ^✱✱	39.62 ± 1.764 ^✱✱
The values are mean ± SEM. n = 5. ^✱, ^✱✱, and ^✱✱✱ indicate the significance level p ≤ 0.05, p ≤ 0.01 and p ≤ 0.001, respectively from placebo. ^#, ^# ^#, and ^{# # #} indicate the significance level p ≤ 0.05, p ≤ 0.01 and p ≤ 0.001, respectively from control.

Table 3. Evaluation of the degree of damage in renal histological sections
	Criteria				Results
Type	0	1	2	3	Control	Placebo	T3	BAI	T3 + BAI
Inflammatory Infiltration	None	Scatter	Focal	Diffuse	0	3	2	2	1
Protein Cast	None	< 10%	10-25%	> 25%	0	2	1	1	1
Interstitial Fibrosis	None	< 25%	25-50%	> 50%	0	3	2	2	1
ECM Deposition	None	< 25%	25-50%	> 50%	0	3	1	2	1
Total					0	11	6	7	4
Each sample was performed based on ten randomly selected fields per section under x400 magnification.

Table 4. Serum parameters for anemia
	Control	Placebo	T3	BAI	T3 + BAI
Hematocrit %	45.93 ± 0.961	35.30 ± 0.6580 ^#	41.32 ± 0.607 ^✱	34.93 ± 0.809 ns	40.86 ± 0.455 ^✱
Hemoglobin (mg/dL)	15.0 ± 0.300	11.5 ± 0.250 ^#	13.2 ± 0.200 ^✱	11.0 ± 0.300 ns	13.1 ± 0.200 ^✱
The values are mean ± SEM. n = 5. ^✱ indicate the significance level p ≤ 0.05 from placebo. ^# Indicate the significance level p ≤ 0.05 from control. ns represent not significant

Table 5. Effects on the serum parameters for minerals and Bone disorders
	Control	Placebo	T3	BAI	T3 + BAI
1,25, dihydroxy vitamin D3 (ng/dL)	6.679 ± 0.27	3.691 ± 0.206 ^#	5.683 ± 0.0364 ^✱✱	4.043 ± 0.0435 ns	5.786 ± 0.211 ^✱✱
ALP activity (U/L)	12.8 ± 0.917	39.9 ± 1.38 ^{# #}	17.4 ± 1.83 ^✱✱	35.8 ± 1.38 ns	18.3 ± 2.75 ^✱✱
Inorganic phosphate (mg/dL)	6.06 ± 0.275	10.8 ± 0.333 ^{# #}	7.95 ± 0.201 ^✱✱	8.22 ± 0.295 ^✱✱	6.20 ± 0.239 ^✱✱
Calcium (mg/dL)	3.31 ± 0.180	1.14 ± 0.0601 ^{# #}	2.25 ± 0.132 ^✱	1.95 ± 0.0721 ^✱	2.75 ± 0.252 ^✱✱
The values are mean ± SEM. n = 5. ^✱, and ^✱✱ indicate the significance level p ≤ 0.05, and p ≤ 0.01, respectively from placebo. ^#, and ^{# #} indicate the significance level p ≤ 0.05, and p ≤ 0.01, respectively from control.

No competing interests reported.

Supplementaryinformation.docx

Download PDF

Editorial decision: Revision requested
02 May, 2025
Reviews received at journal
02 May, 2025
Reviewers agreed at journal
29 Mar, 2025
Reviewers invited by journal
29 Mar, 2025
Editor assigned by journal
27 Mar, 2025
Submission checks completed at journal
26 Mar, 2025
First submitted to journal
25 Mar, 2025

You are reading this latest preprint version

Bidirectional Upregulation of Klotho by Triiodothyronine and Baicalein: Mitigating Chronic Kidney Disease and Associated Complications in Aged BALB/c Mice

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Animal care and treatment

Serum and urine biochemical parameters

ELISA

Histological analysis

RNA isolation and qRT‒PCR analysis

Western blotting analysis

Antioxidant enzyme assay

Catalase assay

SOD activity

Statistical analysis

Results

CKD reduces body weight and improves with bidirectional treatment

Bidirectional treatment ameliorates abnormal serum and urine parameters in CKD animals

Combined treatment (T3 + BAI) maximally counteracts the decline in kidney Klotho levels during CKD

Aberrant increase in GSK-3β expression during CKD is maximally suppressed by T3 + BAI

Combined treatment (T3 + BAI) suppresses the canonical Wnt/β-catenin pathway in CKD animals

Treatments can modulate kidney TGF-β expression

Protective effect against CKD-induced inflammation

T3 but not BAI could protect CKD animals from anemia

T3 but not BAI modulates mineral bone disorders in CKD

Protective effect on CKD-associated cardiovascular risk

Discussion

Conclusion

Abbreviations

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Version 1