The effects of different types of calorie restrictions on epigenetic modifications of age-related genes in aging mouse brain

doi:10.21203/rs.3.rs-6759616/v1

Download PDF

Research Article

The effects of different types of calorie restrictions on epigenetic modifications of age-related genes in aging mouse brain

https://doi.org/10.21203/rs.3.rs-6759616/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

The effects of calorie restriction (CR) on age-related epigenetic modifications have recently been exposed, yet there is a road ahead in explaining the effects of CR on the epigenetic regulations. Although the exact mechanism(s) underlying the beneficial effects of CR on healthy brain aging is still unclear, increasing evidence suggests that epigenetic modifications are promising regulators that may be involved in this phenomenon. Here, we assessed the long-term effects of two different types of CR on DNA methylation levels of nutrient and aging related Igf1r, Adipor1, and Foxo1 genes in aging mice brains. Mice underwent different types of CR-application for up to 72 weeks: Ad-libitum (AL), chronic CR (CCR, 15% CR), and intermittent CR (ICR) alternating one week 60% CR (ICR-R) with three weeks AL feeding (ICR-RF) cyclically. DNA methylation levels were analyzed by pyrosequencing. Expressions of mRNA levels were measured by RT-PCR. Pyrosequencing results revealed that the methylation levels of CpG1 in Igf1r and CpG1-2-5-6-8 in Foxo1 were significantly changed by age in different dietary groups. Average DNA methylation levels were similar in calorie-restricted groups for all genes of interest. The gene expression level of only Igf1r was correlated with the average DNA methylation. In addition, there was a significant positive correlation between CpG5 methylation and Igf1r expression. These findings report that CR may exert its preventive effects on the regulation of nutrient sensing and aging related genes, Igf1r, Adipor1, and Foxo1, by modulating the methylation levels of specific CpG sites rather than altering overall methylation levels.

Brain Aging

Long-term Calorie Restriction

DNA Methylation

Epigenetics

Pyrosequencing

Calorie restriction (CR) is one of the most effective applications that could affect both lifespan and health conditions, and its preventive effects in cancer, diabetes, and neurological diseases have been reported. The application of CR by reducing food intake by 10–40% is reported to enhance memory function, promote neurogenesis, and guard against neurological conditions and age-related diseases (Cox et al., 2019; Greene et al., 2001; Riccio & Rossano, 2015). Two types of CR that have been applied in general: chronic calorie restriction (CCR) and intermittent calorie restriction (ICR). Although most studies are conducted with CCR, recent studies have focused on the ICR in a variety of pathological conditions. In this context, compared to CCR, better protective effects of ICR, which were associated with a decrease in leptin and an increase in adiponectin levels, in mammary tumor development were reported in animal studies (Chen et al., 2016; Dogan et al., 2010, 2017). To better understand the effects of CR, especially ICR, the roles of numerous genes and molecules such as Estrogen, IGF1 (Insulin-like growth factor-1), mTOR, caspases, leptin, adiponectin, sirtuins, and microRNA profiles have been studied (Cicekdal et al., 2019; Dogan et al., 2011, 2017; Ozorhan et al., 2022).

IGF1 and adiponectin exert their regulatory functions through FOXO1, which is a critical transcription factor for longevity, and insulin exerts its effects on neuronal plasticity, metabolism, memory, and cell proliferation by inducing the activation of several downstream pathways, mainly PI3K, AKT, and the mTOR. In addition, FOXO is primarily regulated from upstream signaling through insulin, growth factors, and stress, modulated by nutrient availability, and has roles in the regulation of longevity with changes in nutrient intake. In turn, the longevity effects of decreased Insulin/IGF1 signaling are also shown to be mediated by FOXO activity in the brain (Moll & Schubert, 2012; Zemva et al., 2012). Moreover, transcription of the adiponectin is regulated mainly by the SIRT1/FOXO1 axis and peroxisome proliferator activator receptors (PPARs) (Qiao & Shao, 2006). As FOXO1 could be regulated via adiponectin signaling, FOXO1 itself could also regulate adiponectin and adiponectin receptor gene expression in several tissues, including the liver and brain (Tsuchida et al., 2004). Previous studies have reported the effects of CR on these proteins. On the contrary, it is still unclear how CR exerts its beneficial effects at the molecular level in the aging brain. To better understand the molecular mechanism(s) of the beneficial effects of CR, recent strategies have focused on epigenetic modifications, including DNA methylation and histone modifications, which are indicated as core modulators of aging since the change in the diet is known to cause a shift in the epigenome by aging (Maegawa et al., 2017). Studies have reported the effects of CR on the prevention of age-related CpG methylation changes in tissues other than the central nervous system, including blood and liver (Guarasci et al., 2018; Ramaker et al., 2022; Sziráki et al., 2018). However, reports related to the roles of epigenetic modifications in the brain remain limited, and studies reported promising effects of CR on the regulation of CpG site methylation changes (Hadad et al., 2018; Kim et al., 2016; Pizzorusso & Tognini, 2020; Yin et al., 2022). Yet, there is limited information available about the methylation levels of IGF1, Adiponectin, and FOXO1 signaling in mouse brain, although there are studies about the diet and/or CR and epigenomics.

Since the effects of CR on aging and age-related epigenomic changes recently started to be exposed, there is a road ahead to explaining the effects of CR applications on epigenetic regulations. Here we assessed the effects of long term two different types of calorie restriction, specifically intermittent CR, on the DNA methylation levels of nutrient sensing related Igf1r, Adipor1, and Foxo1 in the aging mouse brain.

2.1 Animals and Study Design. The brain samples used in the present study were obtained from our previous study (Dogan et al., 2021). Briefly, 10-week-old female C57BL/6 mice were randomly divided into three different dietary groups. The first group, the Ad-libitum (AL) group, had food and water available without any restriction throughout the study. The second group is the Chronic Calorie Restriction (CCR) group, in which 15% CR was applied compared to the aged match AL group. The third group is the ICR group, in which three weeks of AL feeding were applied, and followed by one week of 60% CR compared to the aged match AL group in a cyclic manner starting from week 10 to 82 of mouse age. Mice that were sacrificed after one week of restriction period are referred to as ICR-Restricted (ICR-R), and mice that were sacrificed at the end of the three-week refeeding period are referred to as ICR-Refed (ICR-RF). Mice were sacrificed, and brain samples were collected at weeks 10, 49/50, and 81/82. All procedures approved by Yeditepe University Ethics Committee and performed with the guidelines of the Yeditepe University Faculty of Medicine, Experimental Research Center (YUDETAM).

2.2 DNA Isolation. Genomic DNA isolation was performed from the snap-frozen brain tissues. Briefly, samples were homogenized with PBS using 0.05 mm zirconium beads and tissue homogenizer (Next Advance, USA). DNA isolation was performed using DNeasy Blood & Tissue Kit (#69504, Qiagen, Germany). The quality and quantity of the DNA were measured using the NanoDrop 2000 spectrophotometer. The integrity of the DNA was controlled by running 1% agarose gel electrophoresis.

2.3 Sodium bisulfite conversion. EpiTect Bisulfite Kit (#59104, Qiagen, Germany) was used for sodium bisulfite conversion. Subsequently, EpiTect Whole Bisulfitome Kit (#59203, Qiagen, Germany) was used for the amplification of bisulfite-converted DNA. The whole bisulfitome was conducted using 100 ng of DNA samples.

2.4 PCR amplification. Bisulfite-converted and whole bisulfitome amplified DNA samples were further amplified by PCR using biotin-labeled primers specific to Igf1r, Adipor1, and Foxo1 promoter regions. A total of 25 µL PCR product was carried out using PyroMark PCR Kit (#978703, Qiagen, Germany).

2.5 DNA methylation analysis. DNA methylation levels in CpG sites in the promoter regions of Igf1r, Adipor1, and Foxo1 were measured by the Pyrosequencing method. The methylation level of cytosine residues was measured in bisulfite-converted, Igf1r, Adipor1, and Foxo1 amplified DNA samples. Primers targeting five individual CpG sites in the promoter region of Igf1r, three individual CpG sites of Adipor1, and nine individual CpG sites of Foxo1 were purchased from Qiagen (#978746, Qiagen, Germany). The sequences of the individual primers are given in Table 1.

Table 1

List of methylation primer sequences.
Gene Globe ID	Number of CpG Sites		Amplicon Length (bp)
Igf1r PM00387611	5	ATCGCCGCAGGCGAGGACAAACGCCACCCGA	200
Adipor1 PM00208922	3	TCGGTCGGGAAGTTGATGGAGACTCGA	153
Foxo1 PM00342559	9	CGAGGCGCCCCACCGCCCACGTCGCGTCCGGGAGCGCG	218

Igf1r Insulin-like Growth Factor Receptor 1, Adipor1 Adiponectin Receptor 1, Foxo1 Forkhead Box O1

Briefly, 18µL PCR amplified biotinylated DNA samples were immobilized to Streptavidin Sepharose Beads under agitation at 1500 rpm for 20 min (#17511301, GE Healthcare, USA). Immobilized PCR products were purified with 70% EtOH, denatured, and washed with buffers using the Pyrosequencing Vacuum Workstation to generate a single-stranded DNA template. Pyrosequencing primers were annealed to the streptavidin-bonded PCR products and heated at 80°C for 5 min. PyroMark Q24 Cartridge was loaded according to pre-run information provided by PyroMark Q24 Advanced software, and samples were treated using the PyroMark Gold Q24 reagents (#971802 Qiagen, Germany). Sequencing was performed using the PyroMark Q24 system. Quantitative methylation results were obtained as a percentage of individual CpG sites. In each experimental setup, the same sample was used as an inter-assay control, while the water was used as a negative control.

2.6 Analysis of gene expression. The total RNA of tissue samples was isolated using the DirectZol RNA Miniprep Kit (#R2052 Zymo Research, USA). The RNA concentration and purity were determined using the NanoDrop 2000 spectrophotometer. A total of 750 ng RNA samples were reverse transcribed using the iScript cDNA Synthesis Kit (#1708891, Bio-Rad, USA). The cDNA diluted in a 1:5 ratio was used for the quantitative determination of gene expression levels for Igf1r, Adipor1, and Foxo1 using iTaq Universal SYBR Green Supermix (#1725124 Bio-Rad, USA). Self-designed probes (Table 2) were purchased from Sentromer (Sentromer, Turkiye). Quantitative PCR was performed using the BioRad CFX96 Touch Real-Time PCR System (Bio-Rad, USA). Calculations were performed using a comparative cycle threshold (Ct) method. The relative gene expression number was calculated as 2^−ΔΔCt and followed by a normality test. Water was used as a negative control. “n value” is 3–5 for each group, and “n” indicates different individual animals.

Table 2

List of mRNA primer sequences.
Gene	Primer Pairs		Product size (bp)
Igf1r	Forward Reverse	5’-AGG CTC CCT CCT TGA GAT ATA A-3’ 5’-TTG AAC AGT CCC GAG TCA TAA G-3’	84
Adipor1	Forward Reverse	5’-ACG TTG GAG AGT CAT CCC GTA T-3’ 5’-CTC TGT GTG GAT GCG GAA GAT-3’	133
Foxo1	Forward Reverse	5’-TTC TCT CGT CCC CAA CAT CT-3’ 5’-CGA ATA GCA TGG TGT CTG CT-3’	80
B-actin	Forward Reverse	5’-TTC TTT GCA GCT CCT TCG TT-3’ 5’-ATG GAG GGG AAT ACA GCC C-3’	149

Igf1r Insulin-like Growth Factor Receptor 1, Adipor1 Adiponectin Receptor 1, Foxo1 Forkhead Box O1

2.7 Statistical analysis. Data is expressed as mean ± SEM. Statistical analysis was performed using GraphPad Prism 10.0.3 software (GraphPad Software, USA). Statistical analyses were determined by one-way ANOVA followed by the Tukey’s multiple comparison test when comparing three or more groups unless stated otherwise. The Spearman's correlation test was used for correlation analysis. Statistically significant results were considered when p < 0.05. “n value” is 3–5 for each group, and “n” indicates different individual animals.

3.1 The effects of different types of CR and aging on the DNA methylation levels in promoter regions of Igf1r, Adipor1, and Foxo1 in the aging mouse brain

The DNA methylation at specific CpG sites in promoter regions was analyzed to study the effects of different types of CR —CCR and ICR— on the methylation levels in the promoter regions of Igf1r, Adipor1, and Foxo1 in the aging mouse brain. We analyzed five, three, and nine CpG sites in the promoter regions of Igf1r, Adipor1, and Foxo1, respectively. A representative pyrogram result for each gene is given in Suppl. Figure 1A-D. Average DNA methylation at five CpG sites of Igf1r in the AL, CCR, ICR-R, and ICR-RF groups were 4.9%, 3.5%, 6.6%, and 3.6%, respectively, at week 49/50, while they were 4.6%, 4.5%, 2.5%, 3.9% for each dietary group, respectively at week 81/82 (p > 0.05, Suppl. Figure 2A). Average methylation at three CpG sites of Adipor1 in the AL, CCR, ICR-R, and ICR-RF groups were 3.7%, 5.6%, 6.1%, and 4%, respectively, at week 49/50 while it was 4.5%, 3.5%, 6.9%, and 6.3%, respectively at week 81/82 (p > 0.05, Suppl. Figure 2B). Average methylation at nine CpG sites of Foxo1 in the AL, CCR, ICR-R, and ICR-RF groups were 7.6%, 10%, 7.8%, and 5.9% at week 49/50, while it was 8.0%, 8.2%, 9.6%, 6.2% at week 81/82 (p > 0.05, Suppl. Figure 2C). In addition, the average DNA methylation of any gene of interest did not change significantly with aging in any of the dietary groups (p > 0.05, Suppl. Figure 3A-C).

The individual CpG site methylation was investigated to study the effect of different types of CR on the methylation levels of specific CpG sites. Out of five individual CpG sites in the promoter region of Igf1r, only the CpG1 methylation level was 62% significantly lower in the ICR-R group compared to that of the AL group when it was analyzed by student t-test at week 81/82 (p < 0.05, Fig. 1B). In addition, the methylation level of CpG1 site in the CCR group was also 43% lower than the AL group, however, this was not statistically significant. The methylation of the rest of the CpG sites were similar amongst the dietary groups either at week 49/50 or week 81/82 (p > 0.05, Fig. 1). No significant changes were observed in the methylation of three individual CpG sites in the Adipor1 promoter region by different dietary applications (p > 0.05, Suppl. Figure 4A-B). However, methylation of CpG2 and CpG3 were 57% and 100% higher in the CCR group, respectively, compared to the AL group at week 49/50 (p > 0.05, Suppl. Figure 4A). Among the nine individual CpG sites of Foxo1, the methylation level of the CpG6 was 58% lower in the ICR-RF group compared to the AL group at week 49/50 (p < 0.01, Suppl. Figure 5A). The methylation level of the CpG8 in the ICR-RF was also lower compared to the rest of the groups. However, it was only significantly lower, by 50%, compared to the ICR-R group at week 49/50 (p < 0.05, Suppl. Figure 5A). In addition, CR did not have any significant effects on any of the nine CpG sites across the dietary groups at week 81/82 (p > 0.05, Suppl. Figure 5B).

We also assessed the effect of aging on the methylation of individual CpG sites in the promoter regions of Igf1r, Adipor1, and Foxo. In Igf1r, age related changes in methylation of individual CpG sites were significant only in the ICR-R group when analyzed using Student's t-test (p < 0.05, Fig. 2C). Specifically, the methylation level of the CpG1 site was increased by 100% from 10 to week 49/50 and then decreased by 81% from week 49/50 to week 81/82 (p < 0.05, Fig. 2C).

Similarly, the methylation level of the CpG3 site was increased by 60% from 10 to week 49/50 and then decreased by 60% in ICR-R from week 49/50 to week 81/82 (p < 0.05, Fig. 2C). In Adipor1, changes in methylation were similar in all individual CpG sites. In addition, none of the CpG sites were significantly changed by aging in all the dietary groups (p > 0.05, Suppl. Figure 6A-D). In Foxo1, the methylation of CpG2, CpG6 and CpG8 in AL; CpG1, CpG2, CpG5 in CCR; CpG5 in ICR-R; and CpG1, CpG6, CpG8 in ICR-RF were significantly changed by aging (p < 0.05, Fig. 3). The methylation of CpG1 and CpG2 sites decreased steadily from week 10 to week 81/82 by 52% and 61%, respectively, in CCR (p < 0.05, Fig. 3B). On the other hand, the methylation level of the CpG5 site was increased by 408% from 10 to week 49/50, then decreased by 28% from week 49/50 to week 81/82 in the same group.

3.2 The effects of different types of CR and aging on the gene expression levels of Igf1r, Adipor1, and Foxo1 in the aging mouse brain

The gene expression of Igf1r, Adipor1, and Foxo1 were determined to investigate the effects of different types of CR on the mRNA expression in the aging mouse brain. Neither CCR nor ICR applications had significant effects on the mRNA expression of Igf1r and Adipor1 at weeks 49/50 and 81/82 (p > 0.05, Fig. 4A, B). The Foxo1 expression was significantly lower (95%) in the CCR group compared to the ICR-RF group at week 49/50 (p < 0.05, Fig. 4C). In addition, the Foxo1 expression were 32% lower in the CCR group compared to the AL group at week 49/50. This rate was statistically significant when it was analyzed by the student’s t-test (p < 0.05, Fig. 4C). No significant differences in Foxo1 mRNA expression were observed among the dietary groups at week 81/82.

The mRNA expression level of Igf1r significantly decreased with aging regardless of the type of CR applied (p < 0.05, Fig. 5A). On average, Igf1r expression decreased by approximately 56% from week 10 to week 81/82. The Adipor1 expression both in the AL and CCR groups were significantly decreased with aging (p < 0.05, Fig. 5B). On average, Adipor1 expression decreased by approximately 28% from week 10 to week 81/82. The Foxo1 expression were significantly decreased only in the CCR and ICR-RF groups with aging (p < 0.05, Fig. 5C).

The correlation analysis revealed a significant positive correlation between mRNA expression of Adipor1 and Igf1r when data from all time points were pooled (r = 0.9424, p < 0.0001, Fig. 6A). No correlations were found between the Foxo1 and Igf1r, nor Adipor1 and Foxo1 mRNA expression (Fig. 6B, C).

3.3 Correlation between the promoter methylation and gene expression levels

Average CpG methylation and mRNA: A positive correlation was observed between average DNA methylation and mRNA expression of Igf1r when data from all time points and different dietary groups were combined for each specific gene of interest (r = 0.3509, p = 0.0359, Fig. 6D). However, neither Adipor1 nor Foxo1 average methylation were correlated with their mRNA expression (Fig. 6E, 6F). In addition, a positive correlation between the DNA methylation and mRNA expression of Igf1r was observed only in the AL group (r = 0.6164, p = 0.0477, Suppl. Figure 7A). No correlation was observed for any of the dietary groups regarding the genes of interest, Adipor1 and Foxo1 (Suppl. Figure 7B, 7C). Furthermore, when data from all dietary groups across different time points were pooled, no significant correlation was found between average methylation and expression for any of the genes of interest (Suppl. Figure 8A-C).

Specific CpG methylation and mRNA: A strong positive correlation was found only between the CpG5 methylation and Igf1r expression when data from all time points and different dietary groups were combined for each specific of interest (Suppl. Figure 9E). No correlations observed between the methylation of the rest of the CpGs sites and Igf1r expression level (Suppl. Figure 9A-D). Moreover, methylation of none of the CpG sites of Adipor1 or Foxo1 were statistically correlated with their mRNA expression (Suppl. Figure 10A-C, Fig. 11A-I).

Longer life expectancy and lower fertility rates both contribute to an increase in the aging population. Due to the aging of the world population and the rising financial burden of age-related diseases, effective strategies for healthy aging are critically important. In this context, CR, a key epigenetic regulator, has been reported to help healthy aging and prevent age-related diseases both in human and animal models. On the other hand, studies have reported that IGF1R, ADIPOR1, and FOXO1 are important regulators for healthy aging. Up to now, it has been well-established that these regulators are required for normal brain function. However, the roles of DNA methylation in the changes of Igf1r, Adipor1, and Foxo1 expression in the aging brain need further assessments. Therefore, we investigated the effects of different types of calorie restrictions on the DNA methylation levels of Igf1r, Adipor1, and Foxo1, nutrient-sensing related genes to understand their roles in the beneficial effects of CR, especially ICR, in the aging mouse brain.

In the present study, we measured a significant reduction in the Igf1r mRNA in the mouse brain by aging that is consistent with previous studies, which reported a decrease in Igf1 signaling molecules both at the mRNA and protein expression in the hippocampus of aging mice(Hadem & Sharma, 2017; Lee et al., 2014; Logan et al., 2018; Yaghmaie et al., 2006). In the current study, although the level of Igf1r mRNA expression was significantly reduced in all dietary groups by age, this was to a lesser degree in both ICR and CCR groups. This could be one of the mechanisms for the beneficial effects of CR on aging. In the literature, although there are studies reporting the effects of CR on aging, most of them are conducted as short-term (few months) and only a limited number of the studies reported the long-term effects (more than 12 months) of CR on Igf1r expression in aging (Cheng et al., 2003; Hadem & Sharma, 2017; Lee et al., 2014; Logan et al., 2018). To understand the roles of epigenetic in the effects of CR on Igf1r in aging mice brains, DNA methylation levels are measured. In this context, changes in methylation of Gria1, CDK5, and BDNF, in brain tissues in response to aging and different dietary regimens and supplementations have been studied (Arcego et al., 2016; Cai et al., 2019; Tomizawa et al., 2015). Here, our results revealed no significant changes in the average methylation of Igf1r promoter regions among the dietary groups both at weeks 49/50 and 81/82. In addition, the average DNA methylation level does not change with aging. The results in aging are consistent with the recent findings, which report no changes in average DNA methylation of Igf1r in aging rats, from 14 until 88 weeks (Pretsch et al., 2020). Moreover, in the present study, there was a positive correlation between DNA methylation level of Igf1r and its mRNA expression. Although the positive correlation between methylation and mRNA expression was not generally expected, our data highlight the possibility of specific methylation pattern, where certain CpG site methylations within the promoter positively influence gene expression, as also reported by the others (Bell et al., 2011; Gibbs et al., 2010; Van Eijk et al., 2012; Wan et al., 2015).

Previously, CR applications have been shown to cause CpG site methylation changes and age-related methylation drifts in rodents and non-human primates (Hadad et al., 2018; Maegawa et al., 2017; Yin et al., 2022). These results led us to explore the roles of individual CpG site methylation on mRNA expression regulation. In the present study, the methylation of only the CpG1 site of the Igf1r were significantly changed by the CR, while the methylation of CpG1, CpG3, and CpG5 were significantly changed by aging. Our results showed a significant increase in the CpG5 methylation level at week 10 compared to week 81/82 in the ICR-R group, but the mRNA level of the same group was significantly decreased. In the literature, there is no study to report the changes in DNA methylation of specific CpG sites in response to different CR applications.

In this study, we also reported the roles of Adipor1 and Foxo1 since they are involved in the IGF/PI3K/AKT signaling pathway, the main regulator for neuronal survival [36–40]. For example, inhibition of Adipor1, not Adipor2 was reported to reverse the activation of IRS-AKT-FOXO1 signaling by adiponectin (Coope et al., 2008). Here, the average methylation level of the Adipor1 was not changed either by CR or by aging. However, the highest DNA methylation was observed in ICR-R groups at both 49/50 and 81/82 weeks, compared to the AL group. Previously, the higher methylation of LEP and ADIPOQ in response to CR application was reported as a result of 36 hours of fasting in adipose tissue (Hjort et al., 2017). In the current study, the DNA methylation of the Adipor1 promoter region was about 5%, which is similar to that of previously reported studies (Cicekdal et al., 2019; Davé et al., 2015). The mRNA expression of Adipor1 was significantly decreased, while the methylation level of the CpG2 site was increased in the CCR group by aging from week 10 to week 50. These results indicate the regulation of the Adipor1 by CR might modulated by methylation of specific CpG sites of relevant genes. On the other hand, the average promoter methylation of Foxo1 did not show significant changes by dietary application and aging. However, out of nine CpG sites of the Foxo1, compared to the AL group, only methylation of the CpG6 sites were lower in calorie-restricted groups at week 49/50, although this only reached significance in ICR-RF groups. The methylation was also significantly different between ICR-R and ICR-RF groups at week 49/50. Coherently, there is an inverse correlation between Foxo1 mRNA expression and methylation levels of the CpG6 site. Furthermore, while the mRNA expression of the Foxo1 was decreased, some of the specific CpG sites were increased by aging. These results revealed that both long-term and the short-term CR may regulate gene expression via modulating methylation of specific CpGs. In the literature, age-related DNA methylation changes of FOXO1 and IGF1R were reported in human studies (Salas-Pérez et al., 2019). In the present study, there was a significantly positive correlation between Igf1r and Adipor1 mRNA expression. This correlation indicates similarities in their physiological roles. Previously, positive correlation between mRNA expression of Igf1r and Adipor1 in breast cancer and colorectal cancer tissues was reported (Pfeiler et al., 2009; Yunusova et al., 2016). The relationship between promoter methylation and gene expression in response to different dietary applications is not entirely clean-cut and may depend on various factors, including the duration and intensity of the CR and aging.

In summary, we studied the long-term (72 weeks) effects of two different types of calorie restriction (CCR and ICR) on DNA methylation levels in promoter regions of Igf1r, Adipor1, and Foxo1 nutrient sensing and age-related genes in aging mouse brains. Here, we report that rather than total methylation of an individual gene, the methylation of specific CpG sites on the promoter region of nutrient-sensing genes may play more regulatory roles in the modulation of age-related genes by CR in the aging brain. However, it should not be forgotten that this is a complex yet well-orchestrated mechanism of interaction amongst DNA methylation, other epigenetic mechanisms including histone modifications and miRNAs, and other regulatory mechanisms in the preventive effects of CR in aging and age-related diseases need further assessments. Thus, there is still much work to be done to clarify the molecular mechanism(s) behind the beneficial effects of CR, more importantly, ICR, in healthy brain aging. The findings, including those presented in this report, will pave the wave for further clarifications of this phenomenon through future applications of bioinformatic analyses and artificial intelligence.

Authors’ contributions:

A.D. was responsible for the design, literature review, experimental procedures and methodology, data collection and analysis, and writing of the manuscript. B.G.T. provided supervision, contributed to data analysis and interpretation, participated in writing, and conducted a critical review of the manuscript. O.S. was involved in the experimental procedures and methodology, as well as in the interpretation of results and critical review. O.F.B. contributed to writing, provided supervision, and participated in the interpretation of findings and critical review. S.D. contributed to the conception and design of the study, provided supervision, participated in writing, and conducted a critical review of the manuscript.

Data Availability Statement. Data available on request from the authors.

Disclosure. The authors declare that they have no conflicts of interest to disclose.

Ethics Approval Statement. All animal experimental procedures approved by Yeditepe University Ethics Committee and performed with the guidelines of the Yeditepe University Faculty of Medicine, Experimental Research Center (YUDETAM).

Arcego, D. M., Krolow, R., Lampert, C., Toniazzo, A. P., Berlitz, C., Lazzaretti, C., Schmitz, F., Rodrigues, A. F., Wyse, A. T. S., & Dalmaz, C. (2016). Early life adversities or high fat diet intake reduce cognitive function and alter BDNF signaling in adult rats: Interplay of these factors changes these effects. International Journal of Developmental Neuroscience, 50(1), 16–25. https://doi.org/10.1016/J.IJDEVNEU.2016.03.001
Bell, J. T., Pai, A. A., Pickrell, J. K., Gaffney, D. J., Pique-Regi, R., Degner, J. F., Gilad, Y., & Pritchard, J. K. (2011). DNA methylation patterns associate with genetic and gene expression variation in HapMap cell lines. Genome Biology, 12(1). https://doi.org/10.1186/GB-2011-12-1-R10
Cai, H. Bin, Fan, Z. Z., Tian, T., Zhao, C. C., & Ge, Z. M. (2019). Epigenetic Control of CDK5 Promoter Regulates Diabetes-Associated Development of Alzheimer’s Disease. Journal of Alzheimer’s Disease, 69(3), 743–750. https://doi.org/10.3233/JAD-190227
Chen, Y., Ling, L., Su, G., Han, M., Fan, X., Xun, P., & Xu, G. (2016). Effect of Intermittent versus Chronic Calorie Restriction on Tumor Incidence: A Systematic Review and Meta-Analysis of Animal Studies OPEN. Nature Publishing Group. https://doi.org/10.1038/srep33739
Cheng, C. M., Kelley, B., Wang, J., Strauss, D., Eagles, D. A., & Bondy, C. A. (2003). A ketogenic diet increases brain insulin-like growth factor receptor and glucose transporter gene expression. Endocrinology, 144(6), 2676–2682. https://doi.org/10.1210/EN.2002-0057
Cicekdal, M. B., Kazan, B. T., Tuna, B. G., Ozorhan, U., Ekici, I. D., Zhu, F., Suakar, O., Kuskucu, A., Bayrak, O. F., Arcaro, K., Cleary, M. P., Dogan, S., Atasayan, O., & Yilmaz, B. (2019). Effects of two types of energy restriction on methylation levels of adiponectin receptor 1 and leptin receptor overlapping transcript in a mouse mammary tumour virus-transforming growth factor-α breast cancer mouse model. https://doi.org/10.1017/S0007114519002757
Coope, A., Milanski, M., Araújo, E. P., Tambascia, M., Saad, M. J. A., Geloneze, B., & Velloso, L. A. (2008). AdipoR1 mediates the anorexigenic and insulin/leptin-like actions of adiponectin in the hypothalamus. FEBS Letters, 582(10), 1471–1476. https://doi.org/10.1016/J.FEBSLET.2008.03.037
Cox, L. M., Schafer, M. J., Sohn, J., Vincentini, J., Weiner, H. L., Ginsberg, S. D., & Blaser, M. J. (2019). Calorie restriction slows age-related microbiota changes in an Alzheimer’s disease model in female mice. Scientific Reports, 9(1). https://doi.org/10.1038/S41598-019-54187-X
Davé, V., Yousefi, P., Huen, K., Volberg, V., & Holland, N. (2015). Relationship between expression and methylation of obesity-related genes in children. Mutagenesis, 30(3), 411–420. https://doi.org/10.1093/MUTAGE/GEU089
Dogan, S., Cicekdal, M. B., Ozorhan, U., Karabiyik, G., Kazan, B. T., Ekici, I. D., Yilmaz, B., Demirel, P. B., Coban, I., Tuysuz, E. C., Kuskucu, A., Bayrak, O. F., Cleary, M. P., & Tuna, B. G. (2021). Roles of adiponectin and leptin signaling-related microRNAs in the preventive effects of calorie restriction in mammary tumor development. Applied Physiology, Nutrition, and Metabolism = Physiologie Appliquee, Nutrition et Metabolisme, 46(8), 866–876. https://doi.org/10.1139/APNM-2020-1000
Dogan, S., Johannsen, A. C., Grande, J. P., & Cleary, M. P. (2011). Effects of intermittent and chronic calorie restriction on mammalian target of rapamycin (mTOR) and IGF-I signaling pathways in mammary fat pad tissues and mammary tumors. Nutrition and Cancer, 63(3), 389–401. https://doi.org/10.1080/01635581.2011.535968
Dogan, S., Ray, A., & Cleary, M. P. (2017). The influence of different calorie restriction protocols on serum pro-inflammatory cytokines, adipokines and IGF-I levels in female C57BL6 mice: short term and long term diet effects. Meta Gene, 12, 22–32. https://doi.org/10.1016/J.MGENE.2016.12.013
Dogan, S., Rogozina, O. P., Lokshin, A. E., Grande, J. P., & Cleary, M. P. (2010). Effects of chronic vs. intermittent calorie restriction on mammary tumor incidence and serum adiponectin and leptin levels in MMTV-TGF-α mice at different ages. Oncology Letters, 1(1), 167. https://doi.org/10.3892/OL_00000031
Gibbs, J. R., van der Brug, M. P., Hernandez, D. G., Traynor, B. J., Nalls, M. A., Lai, S. L., Arepalli, S., Dillman, A., Rafferty, I. P., Troncoso, J., Johnson, R., Zielke, H. R., Ferrucci, L., Longo, D. L., Cookson, M. R., & Singleton, A. B. (2010). Abundant quantitative trait loci exist for DNA methylation and gene expression in human brain. PLoS Genetics, 6(5), 29. https://doi.org/10.1371/JOURNAL.PGEN.1000952
Greene, A. E., Todorova, M. T., McGowan, R., & Seyfried, T. N. (2001). Caloric restriction inhibits seizure susceptibility in epileptic EL mice by reducing blood glucose. Epilepsia, 42(11), 1371–1378. https://doi.org/10.1046/J.1528-1157.2001.17601.X
Guarasci, F., D’Aquila, P., Mandalà, M., Garasto, S., Lattanzio, F., Corsonello, A., Passarino, G., & Bellizzi, D. (2018). Aging and nutrition induce tissue-specific changes on global DNA methylation status in rats. Mechanisms of Ageing and Development, 174, 47–54. https://doi.org/10.1016/J.MAD.2018.02.001
Hadad, N., Unnikrishnan, A., Jackson, J. A., Masser, D. R., Otalora, L., Stanford, D. R., Richardson, A., & Freeman, W. M. (2018). Caloric restriction mitigates age-associated hippocampal differential CG and non-CG methylation. Neurobiology of Aging, 67, 53. https://doi.org/10.1016/J.NEUROBIOLAGING.2018.03.009
Hadem, I. K. H., & Sharma, R. (2017). Differential Regulation of Hippocampal IGF-1-Associated Signaling Proteins by Dietary Restriction in Aging Mouse. Cellular and Molecular Neurobiology, 37(6), 985–993. https://doi.org/10.1007/s10571-016-0431-7
Hjort, L., Jørgensen, S. W., Gillberg, L., Hall, E., Brøns, C., Frystyk, J., Vaag, A. A., & Ling, C. (2017). 36 h fasting of young men influences adipose tissue DNA methylation of LEP and ADIPOQ in a birth weight-dependent manner. Clinical Epigenetics, 9(1), 1–12. https://doi.org/10.1186/S13148-017-0340-8/TABLES/2
Kim, C. H., Lee, E. K., Choi, Y. J., An, H. J., Jeong, H. O., Park, D., Kim, B. C., Yu, B. P., Bhak, J., & Chung, H. Y. (2016). Short-term calorie restriction ameliorates genomewide, age-related alterations in DNA methylation. Aging Cell, 15(6), 1074–1081. https://doi.org/10.1111/ACEL.12513
Lee, C. H., Ahn, J. H., Park, J. H., Yan, B. C., Kim, I. H., Lee, D. H., Cho, J. H., Chen, B. H., Lee, J. C., Cho, J. H., Lee, Y. L., Won, M. H., & Kang, I. J. (2014). Decreased insulin-like growth factor-I and its receptor expression in the hippocampus and somatosensory cortex of the aged mouse. Neurochemical Research, 39(4), 770–776. https://doi.org/10.1007/s11064-014-1269-3
Logan, S., Pharaoh, G. A., Marlin, M. C., Masser, D. R., Matsuzaki, S., Wronowski, B., Yeganeh, A., Parks, E. E., Premkumar, P., Farley, J. A., Owen, D. B., Humphries, K. M., Kinter, M., Freeman, W. M., Szweda, L. I., Van Remmen, H., & Sonntag, W. E. (2018). Insulin-like growth factor receptor signaling regulates working memory, mitochondrial metabolism, and amyloid-β uptake in astrocytes. Molecular Metabolism, 9, 141. https://doi.org/10.1016/J.MOLMET.2018.01.013
Maegawa, S., Lu, Y., Tahara, T., Lee, J. T., Madzo, J., Liang, S., Jelinek, J., Colman, R. J., & Issa, J. P. J. (2017). Caloric restriction delays age-related methylation drift. Nature Communications 2017 8:1, 8(1), 1–11. https://doi.org/10.1038/s41467-017-00607-3
Moll, L., & Schubert, M. (2012). The Role of Insulin and Insulin-Like Growth Factor-1/FoxO-Mediated Transcription for the Pathogenesis of Obesity-Associated Dementia. Current Gerontology and Geriatrics Research, 2012, 13. https://doi.org/10.1155/2012/384094
Ozorhan, U., Tuna, B. G., Cicekdal, M. B., Kuskucu, A., Bayrak, O. F., Yilmaz, B., Demirel, P. B., Cleary, M. P., & Dogan, S. (2022). Long-term chronic caloric restriction alters miRNA profiles in the brain of ageing mice. The British Journal of Nutrition, 127(5), 641–652. https://doi.org/10.1017/S0007114521001239
Pfeiler, G., Treeck, O., Wenzel, G., Goerse, R., Hartmann, A., Schmitz, G., & Ortmann, O. (2009). Influence of insulin resistance on adiponectin receptor expression in breast cancer. Maturitas, 63(3), 253–256. https://doi.org/10.1016/J.MATURITAS.2009.04.006
Pizzorusso, T., & Tognini, P. (2020). Interplay between Metabolism, Nutrition and Epigenetics in Shaping Brain DNA Methylation, Neural Function and Behavior. Genes 2020, Vol. 11, Page 742, 11(7), 742. https://doi.org/10.3390/GENES11070742
Pretsch, G., Sanadgol, N., Smidak, R., Lubec, J., Korz, V., Höger, H., Zappe, K., Cichna–Markl, M., & Lubec, G. (2020). Doublecortin and IGF-1R protein levels are reduced in spite of unchanged DNA methylation in the hippocampus of aged rats. Amino Acids, 52(4), 543–553. https://doi.org/10.1007/S00726-020-02834-3
Qiao, L., & Shao, J. (2006). SIRT1 Regulates Adiponectin Gene Expression through Foxo1-C/Enhancer-binding Protein α Transcriptional Complex. Journal of Biological Chemistry, 281(52), 39915–39924. https://doi.org/10.1074/JBC.M607215200
Ramaker, M. E., Corcoran, D. L., Apsley, A. T., Kobor, M. S., Kraus, V. B., Kraus, W. E., Lin, D. T. S., Orenduff, M. C., Pieper, C. F., Waziry, R., Huffman, K. M., & Belsky, D. W. (2022). Epigenome-wide Association Study Analysis of Calorie Restriction in Humans, CALERIETM Trial Analysis. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences, 77(12), 2395–2401. https://doi.org/10.1093/GERONA/GLAC168
Riccio, P., & Rossano, R. (2015). Nutrition facts in multiple sclerosis. ASN Neuro, 7(1), 1–20. https://doi.org/10.1177/1759091414568185
Salas-Pérez, F., Ramos-Lopez, O., Mansego, M. L., Milagro, F. I., Santos, J. L., Riezu-Boj, J. I., & Alfredo Martínez, J. (2019). DNA methylation in genes of longevity-regulating pathways: association with obesity and metabolic complications. Aging (Albany NY), 11(6), 1874. https://doi.org/10.18632/AGING.101882
Sziráki, A., Tyshkovskiy, A., & Gladyshev, V. N. (2018). Global remodeling of the mouse DNA methylome during aging and in response to calorie restriction. Aging Cell, 17(3). https://doi.org/10.1111/ACEL.12738
Tomizawa, H., Matsuzawa, D., Ishii, D., Matsuda, S., Kawai, K., Mashimo, Y., Sutoh, C., & Shimizu, E. (2015). Methyl-donor deficiency in adolescence affects memory and epigenetic status in the mouse hippocampus. Genes, Brain and Behavior, 14(3), 301–309. https://doi.org/10.1111/GBB.12207
Tsuchida, A., Yamauchi, T., Ito, Y., Hada, Y., Maki, T., Takekawa, S., Kamon, J., Kobayashi, M., Suzuki, R., Hara, K., Kubota, N., Terauchi, Y., Froguel, P., Nakae, J., Kasuga, M., Accili, D., Tobe, K., Ueki, K., Nagai, R., & Kadowaki, T. (2004). Insulin/Foxo1 pathway regulates expression levels of adiponectin receptors and adiponectin sensitivity. Journal of Biological Chemistry, 279(29), 30817–30822. https://doi.org/10.1074/jbc.M402367200
Van Eijk, K. R., De Jong, S., Pm Boks, M., Langeveld, T., Colas, F., Veldink, J. H., Gf De Kovel, C., Janson, E., Strengman, E., Langfelder, P., Kahn, R. S., Van Den Berg, L. H., Horvath, S., & Ophoff, R. A. (2012). Genetic analysis of DNA methylation and gene expression levels in whole blood of healthy human subjects. https://doi.org/10.1186/1471-2164-13-636
Wan, J., Oliver, V. F., Wang, G., Zhu, H., Zack, D. J., Merbs, S. L., & Qian, J. (2015). Characterization of tissue-specific differential DNA methylation suggests distinct modes of positive and negative gene expression regulation. BMC Genomics, 16(1), 1–11. https://doi.org/10.1186/S12864-015-1271-4/FIGURES/8
Yaghmaie, F., Saeed, O., Garan, S. A., Voelker, M. A., Gouw, A. M., Freitag, W., Sternberg, H., & Timiras, P. S. (2006). Age-dependent loss of insulin-like growth factor-1 receptor immunoreactive cells in the supraoptic hypothalamus is reduced in calorically restricted mice. International Journal of Developmental Neuroscience: The Official Journal of the International Society for Developmental Neuroscience, 24(7), 431–436. https://doi.org/10.1016/J.IJDEVNEU.2006.08.008
Yin, Z., Guo, X., Qi, Y., Li, P., Liang, S., Xu, X., & Shang, X. (2022). Dietary Restriction and Rapamycin Affect Brain Aging in Mice by Attenuating Age-Related DNA Methylation Changes. Genes, 13(4), 699. https://doi.org/10.3390/GENES13040699/S1
Yunusova, N., Spirina, L. V., Frolova, A. E., Afanas’ev, S., Kolegova, E., & Kondakova, I. (2016). Association of IGFBP-6 Expression with Metabolic Syndrome and Adiponectin and IGF-IR Receptor Levels in Colorectal Cancer. Asian Pacific Journal of Cancer Prevention.
Zemva, J., Schilbach, K., Stöhr, O., Moll, L., Franko, A., Krone, W., Wiesner, R. J., & Schubert, M. (2012). Central FoxO3a and FoxO6 expression is downregulated in obesity induced diabetes but not in aging. Experimental and Clinical Endocrinology and Diabetes, 120(6), 340–350. https://doi.org/10.1055/S-0031-1297970/ID/R09-2011-0260-DIA-0016/BIB

No competing interests reported.

SupplementaryMaterialforReview.docx

Download PDF

Editorial decision: Revision requested
05 Jul, 2025
Reviews received at journal
25 Jun, 2025
Reviewers agreed at journal
04 Jun, 2025
Reviewers invited by journal
29 May, 2025
Editor assigned by journal
28 May, 2025
Submission checks completed at journal
27 May, 2025
First submitted to journal
27 May, 2025

You are reading this latest preprint version

The effects of different types of calorie restrictions on epigenetic modifications of age-related genes in aging mouse brain

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials and Methods

3. Results

3.3 Correlation between the promoter methylation and gene expression levels

4. Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1