Mutations of methionine 444 interacting with T1Cu-coordinating amino acids affect the structure and function of multicopper oxidase CopA

doi:10.21203/rs.3.rs-4553086/v1

Download PDF

Research Article

Mutations of methionine 444 interacting with T1Cu-coordinating amino acids affect the structure and function of multicopper oxidase CopA

https://doi.org/10.21203/rs.3.rs-4553086/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 29 Oct, 2024

Read the published version in Biodegradation →

You are reading this latest preprint version

Manganese is an essential trace element for humans, animals, and plants, but excessive amounts of manganese can cause serious harm to organisms. The biological manganese oxidation process mainly oxidizes Mn(II) through the secretion of unique manganese oxidase by manganese-oxidizing bacteria. The T1 Cu site of multicopper oxidase is the main site for substrate oxidation, and its role is to transfer electrons to TNC, where dioxygen reduction occurs. In this study, methionine (Met) No. 444 interacting with the T1Cu-coordinating amino acid in the multicopper oxidase CopA from Brevibacillus panacihumi MK-8 was mutated to phenylalanine (Phe) and leucine (Leu) by the enzyme. Based on the analysis of enzymatic properties and the structural model, the mutant protein M444F with 4.58 times the catalytic efficiency of the original protein CopA and the mutant protein M444L with 1.67 times the catalytic efficiency of the original protein CopA were obtained. The study showed that the manganese removal rate of the manganese-oxidizing engineered bacterium Rosetta-pET-copA^M444L cultured for 7 days was 88.87%, which was 10.77% higher than that of the original engineered bacterium. Overall, this study provides a possibility for the application of genetic engineering in the field of biological manganese removal.

Multicopper oxidase

Site-directed mutagenesis Biological

Manganese removal

Manganese oxidizing bacteria

Manganese (Mn) is the second most abundant transition metal element in the Earth's crust after iron, accounting for 0.10% of the element content in the Earth's crust. Manganese is widely distributed in nature, mainly in oceans, lakes, rocks and various soils and minerals^[1]. In the natural cycle of manganese, there are mainly three valence states of Mn(II), Mn(III) and Mn(IV)^{[2, 3]}.

Manganese is an essential trace element for organisms. The cycling of Mn among Mn(II), Mn(III), and Mn(IV) has a very important impact on human, animal, and plant health. In plants, manganese plays a key role in maintaining the structure of organelles (such as chloroplasts), and once manganese is lacking, it will inhibit photosynthetic oxygen evolution in photosynthesis^[4]. Humans or animals need to consume 5–10 mg of manganese every day. Manganese is involved in the synthesis and activation of many enzymes. It is an essential element for bone growth, energy metabolism, and maintenance of normal endocrine function and is also closely related to the immune function of the human body^[5]. However, long-term intake of excessive manganese can also cause chronic poisoning, which may cause diseases of the central nervous system, reproductive and cardiovascular systems, and manifest symptoms such as mental disorders and motor function degradation^[6]. China is a country rich in groundwater resources. During the mining, smelting, and processing of manganese ore, manganese continuously seeps into the groundwater system, and manganese pollution increases daily. Given the serious harm caused by excessive manganese, the World Health Organization and various countries have strict regulations on manganese content in drinking water. China's "Drinking Water Hygiene Standard" (GB 5749 − 2006) stipulates that the manganese content in drinking water must be strictly controlled at 0.1 mg/L^[7]. In 1996, Zhang put forward the theory of "biological manganese removal and manganese fixation"^[8], which pointed out that under neutral pH conditions, the removal of manganese in water is mainly based on the biological oxidation of manganese-oxidizing bacteria, which is different from the traditional manganese removal technology. In contrast, the advantages of biological manganese removal technology are high manganese removal efficiency, less introduction of chemical agents, and lower engineering cost, so it has become a research hotspot at home and abroad.

The biological manganese oxidation process mainly oxidizes Mn(II) through the secretion of unique manganese oxidase by manganese-oxidizing bacteria^[2]. The screening of manganese-oxidizing bacteria was first reported in 1963. Ehrlich^[9] discovered manganese-oxidizing bacteria from marine manganese nodules, and an increasing number of manganese-oxidizing bacteria have been reported. Manganese-oxidizing bacteria mainly include α-, β- and γ-Proteobacteria, Firmicutes, Actinobacteria^{[2, 10]}, including Bacillus SG-1^[11], Leptothrix discophora SS-1^[12] and SP-6^[13], and Pseudomonas putida MnB1^[14]and GB-1^[15]. The reported manganese oxidase mainly includes multicopper oxidase and manganese peroxidase^[16]. The active site of multicopper oxidase contains 4 Cu ions, which can be divided into 3 types according to their spectral and magnetic characteristics, namely, T1 Cu, T2 Cu, and T3 Cu^[17]. T1 Cu coordinates two histidines, one cysteine , and one axial ligand^[18]. T3 Cu contains two copper atoms, T3a Cu and T3b Cu, each coordinated by three histidine residues^[19]. T2 Cu and two T3 Cus are called trinuclear copper clusters (TNCs)^[20]. The catalytic reaction of multicopper oxidase usually involves the following steps: oxidation of the substrate, electron transfer within the molecule, and reduction of oxygen molecules to water^[19]. Among them, the T1 Cu site is crucial, substrate oxidation occurs near T1 Cu, and electrons are transferred to TNCs through proteins via the Cys-His-N (His) pathway, where dioxygen reduction occurs^{[20, 21]}. Therefore, the researchers conducted in-depth research on the T1 Cu site. Olbrich et al.^[22] mutated the T1 Cu axial ligand methionine M295, which increased the reduction potential and catalytic activity of T1 Cu and changed the hydrophobicity of the T1 Cu axial ligand and the structure of the binding site. Takamura et al.^[23] mutated the T1 Cu axial ligand of McoP, methionine M470, to leucine and phenylalanine, and the redox potential of M470L and M470F was positively shifted by approximately 0.07 V compared with M470, while the catalytic activity for ABTS was increased by 1.2–1.3 times.

A methionine-rich region near the multicopper oxidase T1 Cu is thought to hinder the binding of bulk substrates^[24], but there are few studies on methionine in this region interacting with T1 Cu-coordinating amino acids. Therefore, in this study, the 444th amino acid Met, which interacts with the T1 Cu coordinating amino acid of multicopper oxidase CopA, was mutated to phenylalanine (Phe) and leucine (Leu). Additionally, the kinetic parameters of the enzyme and the simulation structure from Discovery Studio were used to study this site in order to analyze the structural and functional roles of the Met444 residue in electron transport in the CopA redox reaction.

2.1. Materials

Yeast extract, agarose, kanamycin sulfate, and chloramphenicol were purchased from Adamas Reagent (Shanghai, China). Tryptone, 4S Green Plus nontoxic nucleic acid dye, Ni-NTA column, and ABTS were purchased from Sangon Bioengineering (Shanghai, China). The Fast Mutagenesis System was purchased from Transgen Biotechnology (Beijing, China). A BCA protein quantification kit was purchased from Tiangen Biochemical Technology (Beijing, China).

2.2. Bacterial strain

In this experiment, the manganese-oxidizing gene CopA was extracted from Brevibacillus panacihumi MK-8 that was isolated and screened from manganese ore in Loudi, Hunan Province^[25].

2.3. Site-directed mutagenesis

The DNA of the manganese-oxidizing engineered bacterium Rosetta-pET-copA constructed in the previous experiment was used as the mutation template, and the primers shown in Table 1 were used for site-directed mutation. PCR conditions were as follows: 94°C, 3 min; 94°C, 20 s, 55°C, 20 s, 72°C, 2 min, a total of 25 cycles; 72°C, 10 min. Samples were stored at 4°C after completion. The plasmids with the correctly sequenced mutant genes were transferred into Rosetta competent cells, and the obtained mutant strains were named Rosetta-pET-copA^M444F and Rosetta-pET-copA^M444L.

Table 1

Primers required for M444F and M444L
Primer	Sequence (5’ to 3’)
M444F-F	GAAGACATTCACCCTTTTCACCTGCACG
M444F-R	AAAAGGGTGAATGTCTTCAGGCGAACGATTTA
M444L-F	GAAGACATTCACCCTCTGCACCTGCACG
M444L-R	AGAGGGTGAATGTCTTCAGGCGAACGATTTA

2.4. Protein expression and purification

The strains were grown in 100 mL of liquid LB medium (0.5% yeast extract, 1% tryptone, 1% sodium chloride, pH = 7.0) containing 50 µg/mL kanamycin sulfate, 25 µg/mL chloramphenicol, and 0.3 mM Cu²⁺ at 37°C and incubated with shaking at 150 rpm. When the OD₆₀₀ of the bacterial solution reached 0.6–0.8, 0.4 mM IPTG was added, and the culture was shaken at 28°C and 150 rpm to induce protein expression. Approximately 5 h after induction, the bacterial solution was collected, washed twice with deionized water, resuspended in protein buffer (10 mM Tris, 300 mM NaCl, 10 mM imidazole, pH = 7.8), and sonicated on ice for 30 min. The mixture was centrifuged to remove the bacterial pellet. Protein purification was performed using Ni-NTA columns. The protein concentration was determined using a BCA protein quantification kit.

2.5. UV–Vis absorption spectrometry of proteins

The purified CopA, M444F, and M444L proteins were diluted to 50 mg/L, and their UV–visible spectra at 250–700 nm were measured.

2.6. Effects of environmental factors on the oxidation of Mn²⁺ by CopA and its mutant proteins

HCl-Tris buffer (10 mM, pH = 6.9–8.4) was prepared to explore the effect of different pH values on the oxidation of Mn²⁺ by the CopA, M444F, and M444L proteins. The LBB method was used to measure the absorbance at 620 nm using a UV–Vis spectrophotometer to calculate the amount of manganese oxide generated. The relative activity of the protein under different pH conditions was calculated with the highest amount of manganese oxide generated as 100%.

The proteins CopA, M444F, and M444L were treated in a water bath at 37°C-82°C for 1 h to explore the effect of thermal stability on the protein oxidation of Mn²⁺. The determination method was the same as above.

The proteins CopA, M444F, and M444L were reacted in a reaction system with a Cu²⁺ concentration of 0-2.6 mM to explore the effect of the Cu²⁺ concentration on the protein oxidation of Mn²⁺. The determination method was the same as above.

2.7. Effects of environmental factors on the oxidation of ABTS by CopA and its mutant proteins

Sodium acetate buffer (0.2 M, pH = 3.2–7.8) was prepared to explore the effect of different pH values on the oxidation of ABTS by the CopA, M444F, and M444L proteins. The absorbance of the product at 420 nm was measured using a UV–Vis spectrophotometer, the highest yield was 100%, and the relative activity of the protein under different pH conditions was calculated.

The reaction systems were placed at 30℃-80℃ to explore the effect of different temperatures on the oxidation of ABTS by the CopA, M444F, and M444L proteins. The determination method was the same as above.

The proteins were reacted in the reaction system with Cu²⁺ concentrations ranging from 0 mM to 8 mM to explore the effect of different Cu²⁺ concentrations on the oxidation of ABTS by the CopA, M444F, and M444L proteins. The determination method was the same as above.

2.8. Determination of kinetic parameters of proteins

Kinetic parameters were measured using ABTS as substrates. With ABTS as the substrate, using sodium acetate buffer, ABTS was added at a concentration of 50–400 µM and reacted at 50°C for 30 s. Enzyme kinetic parameters were calculated according to the Michaelis–Menten equation and Lineweaver-Burk double-reciprocal method^[26].

2.9. Scanning electron microscopy characterization of protein manganese oxide

Ten milliliters of purified CopA, M444F, and M444L proteins was added to 1 mM Mn²⁺ and 1 mM Cu²⁺ and reacted at 37°C for 7 d. The protein manganese oxide was collected, washed twice with deionized water and dried in an oven at 37°C. The morphology of protein manganese oxide was observed by a JSM7900F scanning electron microscope.

2.10. Fourier transform infrared spectroscopy characterization of protein manganese oxide

Approximately 1 mg of dried protein manganese oxide was added to 100 mg of KBr, ground evenly in an agate mortar, pressed into tablets, and used in an infrared spectrometer to measure the infrared absorption of protein manganese oxide at 400–4000 cm^− 1.

2.11. Protein Discovery studio structural simulation

Using Discovery Studio (2019) Client (BIOVIA, San Diego, CA, USA) software to simulate amino acid mutation of protein CopA, the 3D structures of protein CopA and mutant proteins M444F and M444L were obtained.

2.12. Growth curve determination of strains

The strains were shaken and cultured at 37°C and 150 rpm, samples were taken at 3 h, 6 h, 9 h, 12 h, 24 h, 36 h, 48 h, and 72 h, and the OD₆₀₀ value was determined by a microplate reader. Sampling was stopped when the OD₆₀₀ value was stable. The growth curves of strains Rosetta-pET-copA, Rosetta-pET-copA^M444F and Rosetta-pET-copA^M444L were plotted.

2.13. Manganese removal efficiency of strains

The strain was cultured in LB medium at 37°C and 150 rpm. When the OD₆₀₀ of the bacterial solution reached 0.6–0.8, 0.4 mM IPTG and 1 mM Mn²⁺ were added, and the culture was shaken at 28°C and 150 rpm. Induction of the expressed protein starts the manganese oxidation process at the same time. The bacterial liquids on the 0th, 1st, 4th, and 7th days were collected, and the manganese concentration in the supernatant was measured by ICP–OES (PE 8300) to calculate the manganese removal rate. Parallel samples were also set up.

2.14. Scanning electron microscopy characterization of strain manganese oxide

The strains were cultured in LB medium containing 1 mM Mn²⁺ at 28°C for 7 d with shaking. SEM (S4800, HITACHI, Japan) was used to observe the morphology of biological manganese oxides on the samples at 0, 1, 4, and 7 days (Day 0 refers to the time when 1 mM Mn²⁺ was added).

3.1. UV–Vis Absorption spectra of Proteins

After the purified CopA, M444F, and M444L proteins were diluted to 50 mg/L, their UV–vis spectra at 250–700 nm were measured, as shown in Fig. 1. The CopA, M444F, and M444L proteins all have absorption peaks at 280 nm. Aromatic amino acids, such as tryptophan, tyrosine, and phenylalanine, that are contained in proteins all absorb ultraviolet rays. Tyrosine is at 275 nm, and its ability is slightly weaker; phenylalanine is at 257 nm, and its ability is also the lowest. The absorption peak of tryptophan is at approximately 280 nm, and the absorption ability is the strongest. The main component of its light absorption is the indole ring of tryptophan. The difference in absorbance at 280 nm among the three proteins may be mainly due to the difference in amino acid content.

3.2. Effects of environmental factors on the oxidation of Mn ²⁺ and ABTS by CopA and its mutant proteins

When Mn²⁺ was used as the substrate, as shown in Fig. 2A, from pH = 6.9 to pH = 7.5, almost no manganese oxides were produced in the reaction of CopA, M444F, and M444L. From pH = 7.5 to pH = 7.8, the activity of CopA to oxidize Mn²⁺ increased slowly, and then from pH = 7.8 to pH = 8.4, the activity increased rapidly. In contrast to the original protein CopA, the performances of the mutant proteins M444F and M444L were very similar. The activity of the proteins increased rapidly from pH = 7.8 but was always lower than that of the CopA protein.

As shown in Fig. 2B, the CopA and M444F proteins had the highest protein activity after incubation at 46°C for 1 h and maintained a high activity at 37°C, which was 86% and 88% of the highest activity. However, when the temperature was higher than 46°C, the activities of CopA and M444F decreased sharply, and the protein activities after incubation at 55°C for 1 h were only 73% and 81% of the highest activities. After 1 h of incubation at 82°C, only 59% and 65% of the activities of the CopA and M444F proteins remained. The thermal stability of the mutant protein M444 L was different. The protein activity was the highest after incubation at 55°C for 1 h, and its activity decreased with increasing temperature. After incubation at 82°C for 1 h, the activity remained at only 39%, which was much lower than that of CopA and M444F.

As shown in Fig. 2C, the original protein CopA had the highest activity when the Cu²⁺ concentration was 0.6 mM, and its activity decreased greatly when the Cu²⁺ concentration increased to 1 mM and then decreased slowly with increasing Cu²⁺ concentration. At a concentration of 2.6 mM, its activity was 74% of the highest activity. Unlike the original protein CopA, the mutant proteins M444F and M444L were most active at a Cu concentration of 1 mM. The activity of the mutant protein M444F decreased greatly when the concentration of Cu²⁺ increased to 1.4 mM and then increased slightly with increasing Cu²⁺ concentration, but in general, the activity was much lower than when the concentration of Cu²⁺ was 1 mM. The activity of the mutant protein M444L decreased gradually with increasing Cu²⁺ concentration.

When ABTS was used as the substrate, as shown in Fig. 2D, the proteins CopA, M444F, and M444L all had the highest activity at pH = 3.2. When the pH increased to 4, the protein activity decreased to varying degrees. The protein CopA activity decreased the most, and was 83% of the highest activity. The activity of protein M444F decreased the least, and was 96% of the highest activity, while the activity of protein M444L was 88% of the highest activity. From pH 4.0 to 7.8, the activities of the three proteins fluctuated between 68% and 77% of their peak activity. Overall, the CopA, M444F, and M444L proteins showed roughly the same decreasing trend in pH-dependent activity as ABTS.

As shown in Fig. 2E, the activities of CopA, M444F, and M444L continued to increase from 30°C. At 60°C, the relative activity of protein M444L was the highest, and then the activity continued to decline. At 80°C, the activity decreased to 76% of the highest activity. Both CopA and M444F had the highest relative activity at 70°C. When the temperature increased to 80°C, the relative activity of CopA decreased to 80%, while the relative activity of M444F decreased to 55%. Compared with CopA and M444L, the activity of M444F decreased most obviously.

As shown in Fig. 2F, the activities of the three proteins showed an overall upward trend with increasing Cu²⁺ concentration. The relative activity of CopA decreased to 82% at a Cu²⁺ concentration of 0.6 mM, after which the relative activity increased with increasing Cu²⁺ concentration. The relative activity of protein M444L increased from 84–100%, and the relative activity of protein M444F increased from 79–100%, with the largest increase.

3.3. Kinetic parameter determination

The enzyme kinetic parameters of the original protein CopA and the mutant proteins M444F and M444L with ABTS as the substrate are shown in Table 2. The K_m value of M444F was much larger than that of CopA and was 834.1 ± 8.3 µM, indicating that the M444F mutation greatly reduced the affinity between the protein and the substrate ABTS. In contrast, the K_m value of M444L was lower than that of CopA, and was 138.3 ± 10.4 µM, so the M444L mutation increased the affinity between the protein and the substrate ABTS. The k_cat of M444F was the largest and was 2984 ± 165 min^− 1, which was 1.88 times that of CopA; the k_cat of M444L was the smallest and was 1042 ± 8 min^− 1, 0.66 times that of CopA. The mutation had a significant effect on the rate at which CopA catalyzed the oxidation of the substrate ABTS. The changes in the Michaelis constant K_m and transformation number k_cat directly affected k_cat/K_m, and the results showed that the enzyme catalytic efficiency of M444L was the highest at 7.56 ± 0.63 min^− 1·µM^− 1, which was 1.55 times that of CopA. Although the conversion number k_cat of M444F was the largest, since its affinity with the substrate ABTS is much lower than that of M444L and CopA, its catalytic efficiency was the lowest, at 3.58 ± 0.23 min^− 1·µM^− 1, which was 0.73 of that of the original protein CopA.

The difference in the ability of CopA and the mutant proteins M444F and M444L to catalyze the oxidation of ABTS indicated that the difference in the affinity of different substrates and proteins and the number of conversions affected the ability of the protein to catalyze oxidation.

Table 2

Enzyme kinetic parameters of CopA, M444F and M444L with ABTS as substrate
Enzyme	K_m(µM)	k_cat(min^− 1)	k_cat/K_m(min^− 1·µM^− 1)
CopA	325.0 ± 12.0	1583 ± 12	4.87 ± 0.14
M444F	834.1 ± 8.3	2984 ± 165	3.58 ± 0.23
M444L	138.3 ± 10.4	1042 ± 8	7.56 ± 0.63

3.4. Scanning electron microscopy characterization of protein manganese oxide

As shown in Fig. 3A, the CopA protein manganese oxide is spherical, and its size is uneven, with a diameter of 100 nm-1 µm, and there are clump-like aggregates. M444F protein manganese oxide (Fig. 3B) showed more clump-like aggregates with fewer single spherical monomers and a smaller diameter than CopA protein manganese oxide. The morphology of M444L protein manganese oxide (Fig. 3C) is different from that of the former two, showing a more uniform spherical shape, almost no agglomerate aggregates, and a diameter of approximately 50 nm, which is smaller than that of CopA protein manganese oxide.

Elemental analysis by EDS showed that Mn and O elements were uniformly distributed in the three protein manganese oxides (Fig. 3D-I). The proportion of Mn in CopA protein manganese oxide was 60.37%, and the proportion of O was 39.63%. The proportion of Mn in M444F protein manganese oxide was slightly lower than that of CopA protein manganese oxide, being 57.46%, and the corresponding O element ratio was 42.54%, which may be due to the lower protein concentration of M444F. The catalytic efficiency was higher than that of protein CopA, but the reaction for 7 d made up for the low catalytic efficiency of CopA, so the proportion of Mn elements in protein manganese oxide of CopA was 2.91% higher than that of M444F. The proportion of Mn in M444L protein manganese oxide was not much different from that of CopA and was 59.47%, while the proportion of O was 40.53%.

3.5. Fourier transform infrared spectroscopy of protein manganese oxides

As shown in Fig. 8, the bending vibration peak of Mn-O at 550 cm^{− 1 [27]} and the bending vibration peak of Mn-OH at 1065 cm^{− 1 [28]} confirm that manganese oxidation MnO_x indeed exists. The existence of Mn-O-H suggests that Mn atoms in protein manganese oxides may interact with O atoms through coordination bonds^[28]. The attribution of characteristic peaks from 1230 to 3300 cm^− 1 is shown in Table 3. CopA, M444F, and M444L protein manganese oxides all showed the same characteristic infrared absorption peaks, indicating that mutating methionine 444 to phenylalanine and leucine did not change the chemical bonds of the generated manganese oxides.

Table 3

Assignment of characteristic absorption peaks of protein manganese oxides in FTIR
Wavenumber (cm^− 1)	Bond	Functional group
3300	O-H stretch	H₂O
2921	C-H stretch	C-H groups
1647	–C = C– stretch	Amide I: C-O, C-N, N-H
1518	N–O asymmetric stretch	Nitro compounds
1230	C–N stretch	Aliphatic amines
1065	Mn-O-H bend	MnO_x
550	Mn-O bend	MnO_x

3.6. Discovery studio structural simulation

His442, Cys495 and Met505 are the coordinating amino acids of T1 Cu^[29]. As shown in Fig. 4A, in the original protein CopA, Met444 has the shortest distance to His442, 2.675 Å, Cys495 has a distance of 4.581 Å, and Met505 has the longest distance, 9.385 Å. In the mutant protein M444F (Fig. 4C), the distance between Phe444 and His442 and Met505 became longer, increasing to 2.727 Å and 9.688 Å, respectively, while the distance between Phe444 and Cys495 was only slightly increased to 4.596 Å. In the mutant protein M444L (Fig. 4E), the distances between Leu444 and Cys495 and Met505 were decreased to 4.552 Å and 9.354 Å, respectively, and the distance between Leu444 and His442 (2.684 Å) was slightly increased compared with CopA.

From the perspective of protein amino acid residue interactions, as shown in Fig. 4B, Met444 interacts with the coordinating amino acids His442, Cys495, and Met505 of T1 Cu. Met444 has van der Waals forces with Cys495 and Met505 and alkyl interactions with Cys495. Mutation of Met444 to Phe444 resulted in a Pi-S bond interaction between Phe444 and the T1 Cu ligand Met505 and a hydrogen bond interaction with His442 (Fig. 4D). Similarly, in M444L (Fig. 4F), there is a van der Waals force between Leu444 and Cys495 and a hydrogen bond interaction with His442.

3.7. Growth curves of strains

The growth curves of the original strain Rosetta-pET-copA, mutant strain Rosetta-pET-copA^M444F and Rosetta-pET-copA^M444L are shown in Fig. 5. From 3 h, the growth of the three strains entered the logarithmic growth phase. The growth curve showed that the OD₆₀₀ value increased linearly, the strains grew rapidly in a stable geometric progression, and the growth rate of the strains slowed down significantly from 24 h. The OD₆₀₀ reached the highest value at the 36th hour. Due to the influence of unfavorable factors such as nutrient consumption and accumulation of toxic products in the medium, the bacterial reproduction rate gradually decreased, and the relative bacterial death number began to gradually increase. At 48 h, the OD₆₀₀ value decreased slightly, but the overall change was not significant, and the bacterial growth entered a stable period. The growth conditions of the three strains were not significantly different from 0 to 36 h. From 36 h, the OD₆₀₀ value of the mutant strain Rosetta-pET-copA^M444F was higher than that of the original strain Rosetta-pET-copA and the mutant strain Rosetta-pET-copA^M444L. It is speculated that the mutation of M444F may have an effect on the growth of engineered bacteria. In addition, compared with wild bacteria, engineered bacteria have the advantages of rapid growth and strong reproductive ability^[30].

3.8. Manganese removal ability of strains

In the process of biological manganese oxidation, Mn(II) is first oxidized to the Mn(III) intermediate and then rapidly oxidized to Mn(IV)^[31]. Figure 6 shows the manganese removal rates of the original strain Rosetta-pET-copA and the mutant strain Rosetta-pET-copA^M444F and Rosetta-pET-copA^M444L during 7 days of culture.

On Day 1, the manganese removal rates of the strains were generally similar. The manganese removal rates of the original strain Rosetta-pET-copA and the mutant strain Rosetta-pET-copA^M444F and Rosetta-pET-copA^M444L were 16.60%, 10.83% and 17.08%, respectively. On Day 4, the manganese removal rates of the three strains began to show differences. The manganese removal rates of Rosetta-pET-copA, Rosetta-pET-copA^M444F, and Rosetta-pET-copA^M444L all increased significantly to 62.26%, 49.33%, and 68.07%, respectively. By Day 7, the manganese removal rates of the three strains were significantly different. The original strain Rosetta-pET-copA had a manganese removal rate of 78.10%, Rosetta-pET-copA^M444F had the lowest manganese removal rate of 68.07%, and Rosetta-pET-copA^M444L had the highest manganese removal rate of 88.87%.

Figure 6. Manganese removal efficiency of Rosetta-pET-copA, Rosetta-pET-copA^M444F, and Rosetta-pET-copA^M444L with a 1 mM initial concentration of Mn²⁺

3.9. Scanning electron microscopy characterization of strain manganese oxide

The original strain Rosetta-pET-copA, mutant strain Rosetta-pET-copA^M444F, and Rosetta-pET-copA^M444L were cultured for 7 days under an initial Mn²⁺ concentration of 1 mM. The scanning electron microscope images of the 0th, 1st, 4th, and 7th days of strain culture are shown in Fig. 7 (Day 0 refers to the time when 1 mM Mn²⁺ was added just after the strain was activated).

On Day 0, when they had not yet reacted with Mn²⁺, Fig. 7A-Fig. 7C shows the original morphology of strains Rosetta-pET-copA, Rosetta-pET-copA^M444F, and Rosetta-pET-copA^M444L, being approximately 10–20 µm in length and forming a long rod with a width of 6 µm, which is in line with the morphological characteristics of Escherichia coli. After reacting with Mn²⁺ for 1 day (Fig. 7D-Fig. 7F), the bacterial cells aggregated and formed a state of agglomeration. Compared with the 0th day, the morphology changed slightly, and manganese oxides started to form.

After reacting with Mn²⁺ for 4 days (Fig. 7G-Fig. 7I), the morphology of the strains underwent great changes, and there were more aggregates. The morphology of the Rosetta-pET-copA was shorter than that on Day 0, being approximately 5–10 µm. Compared with the original strain Rosetta-pET-copA, the size of a single cell of the strain Rosetta-pET-copA^M444F was not much different, but the aggregation state was greater. The morphology of the strain Rosetta-pET-copA^M444L was different from that of the former two strains. The size of the bacteria was larger, changing from a long rod shape on Day 0 to an oval shape with irregular edges, approximately 15 µm in length and 10 µm in width.

After reacting with Mn²⁺ for 7 days (Fig. 7J-Fig. 7L), the morphology of the three strains changed further, and the number of manganese oxides significantly increased. Among them, the strain Rosetta-pET-copA and the strain Rosetta-pET-copA^M444F had similar morphologies, resulting in clump-like aggregates. Although the strain Rosetta-pET-copA^M444L was also a clump-like aggregate, its size was larger, approximately 20 µm in length and 15 µm in width.

The transfer of electrons from multicopper oxidase from cysteine residues to T1 Cu produces the blue laccase color and an absorption peak at approximately 600 nm^{[32, 33]}. Those with no absorption peak at 600 nm are called nonblue laccases (white or yellow laccases)^[34]. Figure 1 shows that the CopA protein is a nonblue laccase, and the mutant proteins M444F and M444L are also nonblue laccases. The mutation of methionine 444 to phenylalanine and leucine did not change the type of copper oxidase.

Environmental factors all affect the catalytic activity of the original protein CopA and the mutant proteins. From pH = 7.5 to pH = 7.8, the activity of CopA to oxidize Mn²⁺ increased slowly, while the mutant proteins hardly produced manganese oxide, which may be because the mutation alters the protonation of residues at the T1 Cu site, resulting in a pH-dependent effect on the catalytic activity of the mutants^[35]. The thermal stability of the mutant protein M444L was different from that of CopA and M444F, and the protein activity was the highest after incubation at 55°C for 1 h, which may be due to the influence of amino acid composition on thermal stability^{[36, 37]}. In addition, hydrogen bonding^[38], aromatic ring interactions^[39], and electrostatic interactions^[40] may all affect the thermal stability of proteins. Furthermore, an appropriate concentration of Cu²⁺ can activate the protein to oxidize Mn²⁺, and an excessively high concentration of Cu²⁺ can inhibit protein activity^[41].

The changes in the kinetic parameters of the mutant proteins may be caused by structural changes. The 3D structures of the protein CopA and the mutant proteins M444F and M444L were obtained using Discovery Studio software, and the changes in protein structure and function were analyzed^[42]. As shown in Fig. 4C, in the mutant protein M444F, compared with the original protein CopA, the distance between Phe444 and His442 and Met505 is longer, which may be because Phe has a benzene ring, which makes its steric hindrance larger and increases the distance from His442 and Met505. However, due to the Pi-S bond interaction between Phe444 and the T1 Cu ligand Met505 and the hydrogen bond interaction with His442, the hydrogen bond is stronger than the van der Waals force, so these strong intermolecular interactions make T1 Cu stable in the spatial network of the protein. This accelerates the electron transfer from T1 Cu to TNC^[43], thus improving the catalytic efficiency of the mutant protein M444F, which is 4.58 times that of the original protein. In the mutant protein M444L, the distance between Leu444 and Cys495 and Met505 was reduced, which may be because the side chain length of Leu is smaller than that of Met. Meanwhile, in M444L, the hydrogen bond interaction between Leu444 and His442^[43] resulted in the activity of M444L being 1.70 times higher than that of CopA.

The manganese removal rates of the three strains were significantly different during 7 days. The manganese removal rate of Rosetta-pET-copA^M444L was 88.87%, which was 10.77% higher than that of the original engineered strain Rosetta-pET-copA. The mutant engineering strain Rosetta-pET-copA^M444F had the lowest manganese removal rate, while the protein M444F had a higher Mn²⁺ catalytic oxidation efficiency than CopA and M444L, possibly because M444F had the lowest protein expression and the lowest protein concentration. In addition, the manganese removal rates of the three strains were higher than those of the recombinant engineered strains M15-pQE-cotA^[44] and ECueO^[45].

Based on the scanning electron microscopy images, the morphologies of protein manganese oxide and strain manganese oxide are very different. Most protein manganese oxides are spherical aggregates, while strains are more inclined to agglomerate aggregates. Different strains have different manganese oxidation mechanisms, and their morphologies are also quite different. The biogenic manganese oxides produced by bacterial consortia dominated by the ferromanganese oxidizing bacteria Flavobacterium are mainly composed of some granular particles with a rough and porous surface^[28]. The biogenic manganese oxides formed by the MOB flora AS with Sphingobacterium and Bacillus as the core microorganisms showed irregular shapes and loose structures of different sizes^[46]. The manganese oxides formed by Marinobacter sp. MnI7-9 are fusiform^[47]. Although the manganese oxides produced by the strain Rosetta-pET-copA^M444L are also clump-like aggregates, they are larger than the other two strains, approximately 20 µm in length and 15 µm in width, which is conducive to the attachment of more manganese oxides, and they also have a higher removal rate of manganese.

In this study, the Met444 residue of multicopper oxidase CopA was mutated, and the enzyme kinetic parameters and structural simulation from Discovery Studio were used to study the site to analyze the structure and function of the Met444 residue in the CopA redox reaction effect. Mutations in M444F and M444L alter the structure of the protein and the interactions between amino acid residues, resulting in changes in the dynamics of the protein and in the morphology of the resulting manganese oxides. At the same time, the study obtained manganese-oxidizing proteins M444F and M444L with higher catalytic efficiency than the original protein and a manganese-oxidizing engineering strain Rosetta-pET-copA^M444L with higher manganese removal ability. In conclusion, this study provides a possibility for the application of genetic engineering in the field of biological manganese removal.

Conflict of interest

The authors declared that they have no conflicts of interest to this work. We declare that we do not have any commercial or associative interest that represents a conflict of interest in connection with the work submitted.

Author Contribution

W: Conceptualization; X J: Writing- Original draft preparation;P: Writing-Reviewing and Editing; X L: Writing-Reviewing and Editing; S: Supervision; X Z: Methodology

Acknowledgements

This work was supported by the National Natural Science Foundation of China (No. 22176146); Science and Technology Commission of Shanghai Municipality (No. 19ZR1459400); National Natural Science Foundation of China (No. 21277098); and China Scholarship Council (No.201706265024).

Tebo B M, Ghiorse W C, van Waasbergen L G, et al. Bacterially mediated mineral formation; insights into manganese(II) oxidation from molecular genetic and biochemical studies [J]. Reviews in Mineralogy and Geochemistry, 1997, 35(1): 225–266.
Tebo B M, Bargar J R, Clement B G, et al. Biogenic manganese oxides: Properties and mechanisms of formation [J]. Annual Review of Earth and Planetary Sciences, 2004, 32(1): 287–328.
Tebo B, Clement B G, Dick G J. Biotransformations of manganese [J]. Manual of Environmental Microbiology, 2007: 1223–1238.
McHargue J S. The Effect of manganese on the growth of wheat:A source of manganese for agricultural purposes [J]. Journal of Industrial & Engineering Chemistry, 1919, 11(4): 332–335.
Aschner M, Erikson K M, Hernández E H, et al. Manganese and its role in parkinson’s disease: From transport to neuropathology [J]. Neuromolecular Medicine, 2009, 11(4): 252–266.
Rivera-Mancía S, Ríos C, Montes S. Manganese accumulation in the CNS and associated pathologies [J]. BioMetals, 2011, 24(5): 811–825.
Li C, Wang S, Du X, et al. Immobilization of iron- and manganese-oxidizing bacteria with a biofilm-forming bacterium for the effective removal of iron and manganese from groundwater [J]. Bioresource Technology, 2016, 220: 76–84.
Avery R E, Lutey R W, Musick J, et al. Corrosion of stainless steel piping in high manganese fresh water [J]. Materials Performance, 1996, 35(9): 59–62.
Ehrlich H L. Bacteriology of Manganese Nodules: I. Bacterial Action on Manganese in Nodule Enrichments [J]. Applied Microbiology, 1963, 11(1): 15–19.
Tebo B M, Johnson H A, McCarthy J K, et al. Geomicrobiology of manganese(II) oxidation [J]. Trends in Microbiology, 2005, 13(9): 421–428.
Lee Y, Tebo B M. Cobalt(II) oxidation by the marine manganese(II)-oxidizing Bacillus sp. strain SG-1 [J]. Applied and Environmental Microbiology, 1994, 60(8): 2949–2957.
Nelson, Yarrow, M., et al. Production of biogenic Mn oxides by Leptothrix discophora SS-1 in a chemically defined growth [J]. Applied and Environmental Microbiology, 1999, 65(1): 175–175.
Kim H-S, Pastén P A, Gaillard J-F, et al. Nanocrystalline todorokite-like manganese oxide produced by bacterial catalysis [J]. Journal of the American Chemical Society, 2003, 125(47): 14284–14285.
Caspi R, Tebo B M, Haygood M G. c-Type cytochromes and manganese oxidation in Pseudomonas putida MnB1 [J]. Applied and Environmental Microbiology, 1998, 64(10): 3549–3555.
Vrind J P M d, Brouwers G J, Corstjens P L A M, et al. The cytochrome c maturation operon is involved in manganese oxidation in Pseudomonas putida GB-1 [J]. Applied and Environmental Microbiology, 1998, 64(10): 3556–3562.
Zhou H, Fu C. Manganese-oxidizing microbes and biogenic manganese oxides: characterization, Mn(II) oxidation mechanism and environmental relevance [J]. Reviews in Environmental Science and Bio/Technology, 2020, 19(3): 489–507.
Solomon E I, Baldwin M J, Lowery M D. Electronic structures of active sites in copper proteins: contributions to reactivity [J]. Chemical Reviews, 1992, 92(4): 521–542.
Durão P, Chen Z, Silva Catarina S, et al. Proximal mutations at the type 1 copper site of CotA laccase: spectroscopic, redox, kinetic and structural characterization of I494A and L386A mutants [J]. Biochemical Journal, 2008, 412(2): 339–346.
Jones S M, Solomon E I. Electron transfer and reaction mechanism of laccases [J]. Cellular and Molecular Life Sciences, 2015, 72(5): 869–883.
Solomon E I, Augustine A J, Yoon J. O2 reduction to H2O by the multicopper oxidases [J]. Dalton transactions (Cambridge, England: 2003), 2008, (30): 3921–3932.
Hadt R G, Gorelsky S I, Solomon E I. Anisotropic covalency contributions to superexchange pathways in type one copper active sites [J]. Journal of the American Chemical Society, 2014, 136(42): 15034–15045.
Olbrich A C, Schild J N, Urlacher V B. Correlation between the T1 copper reduction potential and catalytic activity of a small laccase [J]. Journal of Inorganic Biochemistry, 2019, 201: 110843.
Takamura E, Taki S, Sakamoto H, et al. Site-Directed mutagenesis of multicopper oxidase from Hyperthermophilic archaea for high-voltage biofuel cells [J]. Applied Biochemistry and Biotechnology, 2021, 193(2): 492–501.
Kataoka K, Komori H, Ueki Y, et al. Structure and function of the engineered multicopper oxidase CueO from Escherichia coli—deletion of the methionine-rich helical region covering the substrate-binding site [J]. Journal of Molecular Biology, 2007, 373(1): 141–152.
Zeng X, Zhang M, Liu Y, et al. Manganese(II) oxidation by the multi-copper oxidase CopA from Brevibacillus panacihumi MK-8 [J]. Enzyme and Microbial Technology, 2018, 117: 79–83.
Gao J, Truhlar D G. Quantum mechanical methods for enzyme kinetics [J]. Annual Review of Physical Chemistry, 2002, 53: 467–505.
Parikh S J, Chorover J. FTIR spectroscopic study of biogenic Mn-oxide formation by Pseudomonas putida GB-1 [J]. Geomicrobiology Journal, 2005, 22(5): 207–218.
Hou D, Zhang P, Wei D, et al. Simultaneous removal of iron and manganese from acid mine drainage by acclimated bacteria [J]. Journal of Hazardous Materials, 2020, 396: 122631.
Tang W, Liu H, Zeng X. Structural and functional study on cysteine 495, coordinating ligand to T1Cu site in multicopper oxidase CopA [J]. Chemosphere, 2021, 281: 130807.
Ezzell C. Biotechnology bonanza [J]. Nature, 1987, 329(6139): 566–568.
Luther G W, III. Manganese(II) oxidation and Mn(IV) reduction in the environment — two one-electron transfer steps versus a single two-electron step [J]. ChemInform, 2006, 37(20):
Lee S-K, George S D, Antholine W E, et al. Nature of the intermediate formed in the reduction of O₂ to H₂O at the trinuclear copper cluster active site in native laccase [J]. Journal of the American Chemical Society, 2002, 124(21): 6180–6193.
Daroch M, Houghton C A, Moore J K, et al. Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa [J]. Enzyme and Microbial Technology, 2014, 58–59: 1–7.
Mate D M, Garcia-Ruiz E, Camarero S, et al. Switching from blue to yellow: altering the spectral properties of a high redox potential laccase by directed evolution [J]. Biocatalysis and Biotransformation, 2013, 31(1): 8–21.
Zhu Y, Zhang Y, Zhan J, et al. Axial bonds at the T1 Cu site of Thermus thermophilus SG0.5JP17-16 laccase influence enzymatic properties [J]. FEBS Open Bio, 2019, 9(5): 986–995.
Huang J, Jones B J, Kazlauskas R J. Stabilization of an α/β-hydrolase by introducing proline residues: Salicylic acid binding protein 2 from tobacco [J]. Biochemistry, 2015, 54(28): 4330–4341.
Deckert G, Warren P V, Gaasterland T, et al. The complete genome of the hyperthermophilic bacterium Aquifex aeolicus [J]. Nature, 1998, 392(6674): 353–358.
Shirley B A, Stanssens P, Hahn U, et al. Contribution of hydrogen bonding to the conformational stability of ribonuclease T1 [J]. Biochemistry, 1992, 31(3): 725–732.
Burley S K, Petsko G A. Aromatic-Aromatic Interaction: A Mechanism of Protein Structure Stabilization [J]. Science, 1985, 229(4708): 23–28.
Strickler S S, Gribenko A V, Gribenko A V, et al. Protein stability and surface electrostatics: A charged relationship [J]. Biochemistry, 2006, 45(9): 2761–2766.
Decembrino D, Girhard M, Urlacher V B. Use of copper as a trigger for the in vivo activity of E. coli laccase CueO: A simple tool for biosynthetic purposes [J]. ChemBioChem, 2021, 22(8): 1470–1479.
Temml V, Kaserer T, Kutil Z, et al. Pharmacophore modeling for COX-1 and – 2 inhibitors with LigandScout in comparison to Discovery Studio [J]. Future Medicinal Chemistry, 2014, 6(17): 1869–1881.
Zhang Y, Dai Z, Zhang S, et al. The catalytic properties of Thermus thermophilus SG0.5JP17-16 laccase were regulated by the conformational dynamics of pocket loop 6 [J]. Biochimica et Biophysica Acta (BBA) - General Subjects, 2021, 1865(6): 129872.
Su J, Bao P, Bai T, et al. CotA, a multicopper oxidase from Bacillus pumilus WH4, exhibits manganese-oxidase activity [J]. PloS One, 2013, 8(4): e60573.
Su J, Deng L, Huang L, et al. Catalytic oxidation of manganese(II) by multicopper oxidase CueO and characterization of the biogenic Mn oxide [J]. Water Research, 2014, 56: 304–313.
Wan W, Xing Y, Qin X, et al. A manganese-oxidizing bacterial consortium and its biogenic Mn oxides for dye decolorization and heavy metal adsorption [J]. Chemosphere, 2020, 253: 126627.
Hu Y, Chen X, Liu Z, et al. Activated carbon doped with biogenic manganese oxides for the removal of indigo carmine [J]. Journal of Environmental Management, 2016, 166: 512–518.

No competing interests reported.

Download PDF

Journal Publication

published 29 Oct, 2024

Read the published version in Biodegradation →

Editorial decision: Revision requested
09 Aug, 2024
Reviews received at journal
08 Aug, 2024
Reviews received at journal
16 Jul, 2024
Reviewers agreed at journal
06 Jul, 2024
Reviewers agreed at journal
04 Jul, 2024
Reviewers invited by journal
04 Jul, 2024
Editor assigned by journal
10 Jun, 2024
Submission checks completed at journal
10 Jun, 2024
First submitted to journal
09 Jun, 2024

You are reading this latest preprint version

Mutations of methionine 444 interacting with T1Cu-coordinating amino acids affect the structure and function of multicopper oxidase CopA

Status:

Journal Publication

Version 1

Abstract

Figures

1. Introduction

2. Materials and methods

2.1. Materials

2.2. Bacterial strain

2.3. Site-directed mutagenesis

2.4. Protein expression and purification

2.5. UV–Vis absorption spectrometry of proteins

2.6. Effects of environmental factors on the oxidation of Mn2+ by CopA and its mutant proteins

2.7. Effects of environmental factors on the oxidation of ABTS by CopA and its mutant proteins

2.8. Determination of kinetic parameters of proteins

2.9. Scanning electron microscopy characterization of protein manganese oxide

2.10. Fourier transform infrared spectroscopy characterization of protein manganese oxide

2.11. Protein Discovery studio structural simulation

2.12. Growth curve determination of strains

2.13. Manganese removal efficiency of strains

2.14. Scanning electron microscopy characterization of strain manganese oxide

3. Results

3.1. UV–Vis Absorption spectra of Proteins

3.3. Kinetic parameter determination

3.4. Scanning electron microscopy characterization of protein manganese oxide

3.5. Fourier transform infrared spectroscopy of protein manganese oxides

3.6. Discovery studio structural simulation

3.7. Growth curves of strains

3.8. Manganese removal ability of strains

3.9. Scanning electron microscopy characterization of strain manganese oxide

4. Discussion

5. Conclusion

Declarations

Conflict of interest

Author Contribution

Acknowledgements

References

Additional Declarations

Status:

Journal Publication

Version 1

2.6. Effects of environmental factors on the oxidation of Mn²⁺ by CopA and its mutant proteins