Investigating the Osteogenic Potential of Quercetin in Lipopolysaccharide Treated Human Periodontal Ligament Stem Cells- an Invitro Study

doi:10.21203/rs.3.rs-8172316/v1

Download PDF

Article

Investigating the Osteogenic Potential of Quercetin in Lipopolysaccharide Treated Human Periodontal Ligament Stem Cells- an Invitro Study

https://doi.org/10.21203/rs.3.rs-8172316/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Aim: This study aimed to investigate the therapeutic potential of Quercetin in mitigating Lipopolysaccharide-induced inflammatory suppression and promoting osteogenic differentiation in human Periodontal Ligament Stem Cells (hPDLSCs).

Materials and Methods: hPDLSCs were cultured with LPS to create an inflammatory microenvironment. Cells were then treated with Quercetin at concentrations of 2.5 µM, 5 µM, and 10 µM. The mRNA expression levels of key osteogenic markers, Osteopontin (OPN) and Osteocalcin (OCN), were quantified using real-time quantitative PCR on Day 14. Statistical analysis employed Welch one-way ANOVA and Games–Howell for pairwise comparisons.

Results: LPS significantly suppressed the expression of both OPN and OCN compared to the control group. However, Quercetin treatment effectively restored and dose-dependently upregulated these markers. The highest efficacy was observed at 10 µM Quercetin, which resulted in OPN expression of and OCN expression of relative to the control. A strong monotonic upregulation for both markers was confirmed, indicating enhanced osteogenic differentiation.

Discussion and Conclusion: This study demonstrates that Quercetin effectively counteracts LPS-induced osteogenic suppression in hPDLSCs, suggesting its capacity to modulate inflammatory and differentiation pathways. These findings highlight Quercetin's significant therapeutic potential as a natural compound for novel periodontitis therapies and for promoting periodontal tissue regeneration. Future research should focus on optimizing dosage and exploring long-term effects.

Health sciences/Diseases/Oral diseases/Periodontitis

Health sciences/Health care/Dentistry/Periodontics

Quercetin

Lipopolysaccharides

human Periodontal Ligament Stem Cells

Osteopontin

Periodontal regeneration

Osteocalcin.

Periodontal disease is a chronic inflammatory condition comprising of mainly, the gingivitis and periodontitis, that causes progressive destruction of the periodontium, ultimately resulting in tooth loss if left untreated.¹ It is particularly more prevalent among elderly population and is not uncommon in younger individuals.² The oral cavity contains around 700 species of bacteria, thus forming a unique and complex microbial environment with diverse ecosystem, many of which plays a vital role in the onset and advancement of periodontitis.³

The Periodontal Ligament Stem Cells (PDLSCs) are one of the key host factors in periodontal regeneration, notable for its properties such as immunomodulation, multipotency, etc. These PDLSCs are a specific subgroup of mesenchymal stem cells which has osteogenesis and regeneration properties, rendering them especially advantageous for applications related to periodontal disorders. Due to their multipotential capacity to differentiate into various types of cells, PDLSCs can modulate immune responses enables effective and sustained periodontal repair. Upon activation, PDLSCs migrate to the site of concern and facilitate tissue regeneration through differentiation and secretion of bioactive substances. Hence, PDLSCs are considered the ideal cellular source for periodontal repair and regeneration.⁴

The human Periodontal Ligament Stem Cells (hPDLSCs) are usually triggered during inflammatory periodontal conditions Lipopolysaccharide (LPS), a potent endotoxin present in the outer membrane of the highly asymmetric phospholipid bilayer of gram-negative bacteria. LPS is a significant microbiological contributor to periodontal disease as it forms the initial interface between bacterial pathogens and the human immune system.⁵ LPS induces an inflammatory response that degrades bone and connective tissue. As the disease progresses, LPS elevates the concentrations of pro-inflammatory cytokines, including interleukins and C-reactive proteins.⁶ It results in gingival bleeding, recession, and in extreme cases, mobility and tooth loss.⁷ Among gram-negative bacteria, Porphyromonas gingivalis is regarded as the keystone bacterium in the pathophysiology of periodontitis. The lipopolysaccharides (LPS) of P. gingivalis is especially effective in sustaining chronic inflammation by activating Toll-like receptors (TLRs), notably TLR4, which in turn initiates downstream signalling cascades involving transcription factors like nuclear factor-kappa B (NF-κB), thus resulting in the synthesis of diverse inflammatory mediators.⁸

Recognizing the constraints of traditional treatment approaches, natural compounds with anti-inflammatory and regenerative properties are gaining significant interest. Quercetin (Qrn), a plant-derived polyphenolic flavonoid, is abundant in fruits (e.g., apples, berries, grapes), vegetables (e.g., onions, broccoli, cabbage), and other plant parts like seeds and leaves.^9,10 Quercetin is known for its broad-spectrum pharmacological activities, including anti-allergic, anti-inflammatory, anti-tumour, antiviral, and cardiovascular protective effects.¹¹ It has been approved by the U.S. FDA as a component in antioxidant and anti-allergic formulations.¹²

Mechanistically, Quercetin exerts its anti-inflammatory effects by inhibiting cyclooxygenase (COX) and lipoxygenase (LOX) enzymes, which are key mediators in the arachidonic acid pathway⁸. Moreover, it has been demonstrated to reduce oxidative stress, diminish osteoblast apoptosis, and inhibit RANKL-induced osteoclastogenesis.¹³

This study investigated the osteogenic potential of Quercetin in an LPS-induced inflammatory environment using hPDLSCs, evaluating osteogenic gene markers (OPN and OCN) to determine its efficacy in restoring osteogenic differentiation under inflammatory stress conditions.

Isolation and Cultivation of human Periodontal ligament Stem-cells (hPDLSCs)

Human Periodontal Ligament stem-cells were obtained from healthy adults (aged 18 to 25 years) from teeth extracted for orthodontic procedure at SRM Kattankulathur Dental College and Hospitals, Chengalpattu. The study protocol was approved by the Institutional Ethical Committee (SRMIEC-ST0525-2583), and all participants provided informed consent. The isolation of human periodontal ligament fibroblasts was conducted through enzymatic digestion using collagenase (900 u/mL) and dispase (400 u/mL) at 37°C for 1 hour. Primary dental stem cell cultures were conducted using RPMI 1640 (Invitrogen Corporation, CA, USA) enriched with 20% (v/v) fetal bovine serum, 100 U/mL penicillin, and 100 µg/mL streptomycin at 37°C in a 5% CO2 atmosphere. The culture medium was replaced every three days and subcultured at 80% confluence. At passage 2, cells were seeded in culture dishes in all in vitro experiments conducted for this study.

Cell Culture

Human periodontal ligament stem cells (hPDLSCs) were cultured in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin and was maintained at 37°C in a 5% CO₂ humidified atmosphere.

Experimental Groups

The cells were grown under 5 different conditions: For Group 1 (control group), hPDLSCs cells were cultured without LPS or Quercetin. For Group 2 (LPS group), hPDLSCs were cultured with LPS (10 µg/mL) to induce inflammation, which supresses the expression of OPN and OCN compared to the control group (p < 0.05). For Group 3, hPDLSCs were pretreated with Quercetin (2.5 µM) for two hours, followed by co-culture with LPS (LPS with Quercetin at 2.5 µM). For Group 4 (LPS with Quercetin at 5 µM), hPDLSCs were subjected to treatment with Quercetin at 5 µM concentrations followed by LPS. For Group 5 (LPS with Quercetin at 10 µM)., hPDLSCs were treated with Quercetin at 10 µM concentrations in combination with LPS stimulation.

qPCR Analysis (Day 14 for OPN/OCN)

Total RNA was extracted using TRIZOL, and cDNA synthesis was done using a reverse transcription kit. qPCR was performed using SYBR Green Master Mix on the following genes:

The Osteogenic markers, OPN and OCN identified on Day 14. The Housekeeping gene was GAPDH (Glyceraldehyde-3-phosphate dehydrogenase) enzyme.

RNA Isolation and Reverse Transcription Quantitative PCR (RT-qPCR):

Total RNA extraction was performed with TRIZOL reagent (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. Nanodrop ND 100 (Thermo Fisher Scientific, Waltham, MA, USA) was utilized for UV spectrometric measurements at 260 nm and 280 nm to establish the quantity and purity of the RNA. The Prime-Script RT Reagent Kit (Perfect Real Time, TAKARA, Shiga, Japan) was used to synthesize complementary DNA (cDNA) from 500 ng of RNA, adhering to the provided instructions. A quantitative real-time polymerase chain reaction (qPCR) was performed using KAPA SYBR Fast Master Mix (2x) Universal (Kapa Biosystems, Sigma, Darmstadt, Germany) in the Connect Bio-Rad real-time PCR system (Bio-Rad, Hercules, CA, USA). Two osteogenesis-related markers were chosen to be analysed, IL-6, IL-8, OPN and OCN. The Primer-Blast software (http://www.ncbi.nlm.nih.gov/BLAST) was employed for primer design, as given in Table 1. The amplification profiles for PCR were optimized for primer sets. For IL-6, IL-8, OPN, and OCN, the real-time PCR reactions were carried out at 95°C for 3 minutes, followed by 40 amplification cycles comprising 95°C for 3 seconds and 58°C for 30 seconds. The procedure was performed using the dissociation curve, starting at 65°C for 5 seconds and gradually increasing to 95°C in 0.5°C increments. The data were analysed utilizing Bio-Rad CFX Manager software version 3.0. The relative expression levels of the target genes were quantified using the ΔΔCq method, with Cq denoting the threshold cycle, following normalization to the housekeeping gene beta-actin. Data were analysed in duplicate at each time point.

Table 1
Primers sequences for GAPDH, OCN and OPN
Gene	Forward Primer (5′–3′)	Reverse Primer (5′–3′)
GAPDH	AGCCACATCGCTCAGACAC	GCCCAATACGACCAAATCC
OCN	CAGCGAGGTAGTGAAGAGACC	AGAGCGACACCCTAGACCG
OPN	AGCCACAAGTTTCACAGCCACA	TCGTCATCATCATCGTCATCATCC

Statistical analysis

Analyses were performed by R 4.5.1 (R Foundation for Statistical Computing, Vienna, Austria) dwith rstatix, Kendall, and clinfun. qPCR data were normalized as ΔCt, centered as ΔΔCt, and reported as fold-change = 2^−ΔΔCt; all tests were conducted on ΔCt (additive/variance-stable scale). Group ΔCt distributions were checked via Shapiro–Wilk and Levene; because heteroscedasticity was present, we applied Welch one-way ANOVA on ΔCt for each marker. For pairwise inference, we used Games–Howell (all pairs) and, for targeted contrasts of LPS vs Quercetin (2.5, 5, 10 µM), Welch two-sample t-tests with Holm correction across those three comparisons (two-tailed, α = 0.05). Given the ordered doses and the expectation of up-regulation, we quantified monotonic dose–response on ΔCt within 2.5→5→10 µM using a directional Kendall’s τ (JT-equivalent) with the alternative that ΔCt decreases with dose. Results are shown as fold-change (mean ± SEM); asterisks denote p < 0.05 after adjustment.

Table.2 shows LPS suppressed osteogenic markers (OPN ~ 0.21×; OCN ~ 0.45× vs Control), whereas quercetin restored and then enhanced expression in a dose-ordered manner (e.g., OPN ≈ 1.0×, 3.6×, 5.8×; OCN ≈ 1.7×, 3.9×, 6.6× at 2.5, 5, 10 µM). All quercetin doses differed from LPS (Holm-adjusted p < 0.01), and dose–response trend tests on ΔCt confirmed monotonic upregulation (directional Kendall’s τ ≈ −0.89 for OPN and − 0.87 for OCN; p ≈ 0.001 each; negative τ indicates decreasing ΔCt with dose, i.e., increasing expression).

Table 2
OPN and OCN mRNA (Fold-Change vs Control; mean ± SEM, n = 3/group)
Gene	Control	LPS (10 µg/mL)	LPS + Q 2.5 µM	LPS + Q 5 µM	LPS + Q 10 µM
OPN	1.00 ± 0.00	0.21 ± 0.03ᵃ	1.02 ± 0.04ᵇ	3.57 ± 0.12ᶜ	5.80 ± 0.26ᵈ
OCN	1.00 ± 0.00	0.45 ± 0.03ᵃ	1.74 ± 0.07ᵇ	3.87 ± 0.07ᶜ	6.61 ± 0.18ᵈ

The graph depicts the relative mRNA expression levels of Osteopontin (OPN) normalized to GAPDH in different treatment groups. Lipopolysaccharide (LPS) stimulation (10 µg/mL) significantly downregulated OPN expression compared to the control. However, treatment with Quercetin (Qrn) in increasing concentrations (2.5 µM, 5 µM, and 10 µM) in the presence of LPS led to a dose-dependent upregulation of OPN expression. Notably, the highest

expression was observed in the LPS + Qrn (10 µM) group, indicating that quercetin effectively counteracts LPS induced suppression and promotes OPN mRNA expression in a concentration-dependent manner.

The graph illustrates the relative mRNA expression levels of OCN, normalized to GAPDH, across different treatment groups. Exposure to lipopolysaccharide (LPS,10 µg/mL) resulted in a marked reduction in OCN expression compared to the untreated control group. However, co-treatment with Quercetin (Qrn) at increasing concentrations (2.5 µM, 5 µM, and 10 µM) led to a progressive, dose-dependent restoration and enhancement

of OCN expression. The highest upregulation was observed in the LPS + Qrn (10 µM) group, suggesting that Quercetin effectively reverses LPS-induced suppression and promotes osteogenic gene expression in a concentration-dependent manner. This pattern aligns with Quercetin’s pro-osteogenic mechanisms: dampening of NF-κB and inflammatory signalling (removing an anti-osteogenic block), and activation of pathways that favour differentiation—Runx2, BMP/Smad, and potentially Wnt/β-catenin—alongside Nrf2-mediated cyto-protection. OPN (matrix adhesion/mineralization) and OCN (late osteoblast marker) moving upward together indicates both commitment and maturation of the osteogenic program by Day 14 despite prior LPS stress.

OPN and OCN increased orderly with dose (2.5 →5 →10 µM). Directional Kendall’s τ on ΔCt indicated a strong monotonic upregulation for both markers (negative r with significant p), consistent with enhanced osteogenic differentiation.

Periodontal homeostasis is maintained by the process of bone formation and resorption, known as coupling. In periodontitis, however, this balance is disrupted by osteoclast-mediated bone resorption, leading to inflammation and tissue destruction.¹⁴ The primary goal in management of Periodontal disease is to halt the progression of the disease and to restore the lost periodontal tissues.¹⁵ Non-surgical management including scaling and root planing (SRP) may be effective in mild to moderate cases but is often insufficient for deep periodontal pockets with infra-bony defects, or furcation involvements.¹⁶ In such cases, surgical procedures, including resective and regenerative osseous surgery, combined with ongoing periodontal maintenance therapy, becomes necessary.¹⁷ Although these methods assist in preventing disease progression, their capacity to regenerate the lost periodontium remains restricted.¹⁸ These limitations underscore the need for novel therapeutic strategies that can effectively promote tissue regeneration in the complex inflammatory microenvironment characteristic of periodontitis.¹⁹

PDLSCs are progenitor cells within the PDL, capable of proliferation and differentiation, thus offering a promising avenue for true periodontal tissue regeneration.²⁰ Quercetin, a major flavonoid, has exhibited notable effectiveness in reducing inflammation and enhancing osteoblastic differentiation in PDL cells, rendering it a focus of extensive research for its potential role in periodontal regeneration.^21,22 Studies of Mooney et al.²¹,2021, revealed that Quercetin has the potential to diminish alveolar bone loss and gingival inflammation in experimental periodontitis. The present study assessed the therapeutic potential of Quercetin by analysing its effect on two osteogenic markers (OPN and OCN), within an inflammatory environment induced by LPS to simulate periodontitis. OPN and OCN are major non-collagenous proteins that plays a major role in bone matrix formation and deposition.²³ OPN is a multifunctional signaling glycoprotein, majorly produced by immune cells, osteoblasts, osteoclasts, endothelial as well as epithelial cells. OCN, also known as the Gla-protein is the most abundant non-mineralized bone protein with high affinity to Calcium. It is secreted by osteoblasts, odontoblasts and chondrocytes.²⁴ OPN is an early marker of bone differentiation while OCN is a late marker in bone matrix deposition and mineralization.²⁵

The present study showed that LPS significantly suppressed the OPN and OCN expression compared to the control group. Quercetin treatment restored OPN and OCN levels dose-dependently, reaching 1.02 ± 0.04 at 2.5 µM, 3.57 ± 0.12 at 5 µM and 5.80 ± 0.26 at 10 µM and OCN levels reaching 1.74 ± 0.07 at 2.5 µM, 3.87 ± 0.07 at 5 µM and 6.61 ± 0.18 at 10 µM. These findings demonstrate Quercetin’s potential to counteract LPS-induced suppression of OPN and OCN expression. The results obtained from the present study is consistent with those of Manuel et al.,2015, who demonstrated that Quercetin at a concentration of 200 µM enhanced mineralization and alkaline phosphatase activity in human mesenchymal stem cells while attenuating inflammatory responses in gingival fibroblasts under IL-1β stimulation.²⁶ Similarly, the study by Yu Wei et al., 2021, reported that Quercetin at 5 µM protects hPDLSCs from oxidative stress-induced senescence and preserving osteogenic potential via upregulation of ALP, Runx2, and OCN by enhancing the expression of antioxidant enzyme-related genes, including HO-1, NQO-1, GPx3 and CAT and elevated Superoxide dismutase (SOD) activity.²⁷

Based on the in-vitro results, Quercetin upregulated the osteogenic markers in a dose-dependent manner, with 10µM being the most effective concentration. These findings endorse the osteogenic potential of Quercetin for periodontal applications within an inflammatory microenvironment. However, the limitations of this study encompass the necessity to examine a wider dosage spectrum in order to more extensively analyse the dose-dependent effects and identify optimal therapeutic levels. Long-term studies are necessary to assess the enduring effects of Quercetin on hPDLSCs differentiation and bone regeneration. Further researches should include supplementary markers such as Runx2, COL1, BMP, etc., so as to offer a more thorough comprehension of the effects of Quercetin.

In conclusion, the present study demonstrated that Quercetin reverses LPS-induced inhibition of osteogenic differentiation in hPDLSCs. These findings highlight its potential as a natural bioactive compound for periodontal regeneration. These findings suggest that Quercetin functions as a bio-modulatory molecule, offering a promising natural compound for soft and hard tissue regeneration. Further in vivo studies are recommended to confirm its therapeutic applicability in Periodontal regeneration therapy.

Conflict of Interest

The authors do not have any personal interest that may influence this study. All interpretations and analysis were conducted equitably, without commercial or financial interest that could be interrupted as a possible conflict.

Authors contribution

All authors have thoroughly evaluated the final version intended for publication and have collectively accepted responsibility for all aspects of the work.

Concept and design: Prem Blaisie Rajula, Srishta Radhakrishnan, Ravishankar PL Merita Stanley, Rahila C., Acquisition, analysis, or interpretation of data: Ravishankar PL, Rahila C., Srishta Radhakrishnan, Merita Stanley, Prem Blaisie Rajula, Drafting of the manuscript: Srishta Radhakrishnan, Merita Stanley, Rahila C., Prem Blaisie Rajula, Ravishankar PL. Critical review of the manuscript for important intellectual content: Merita Stanley, Prem Blaisie Rajula, Srishta Radhakrishnan, Ravishankar PL. Supervision: Ravishankar PL, Merita Stanley, Srishta Radhakrishnan, Prem Blaisie Rajula.

Acknowledgement

The authors would also like to express gratitude to SRM Kattankulathur Dental College and Hospital, Faculty of Medicine and Health Sciences, SRMIST, Kattankulathur for providing the institutional support necessary for the development of this research.

Disclosures

Human subjects: Consent for treatment and open access publication was obtained by all participants in this study. Institutional Ethical Committee Review Board of SRM Kattankulathur Dental College and Hospital issued approval SRMIEC-ST0525-2583 for this study. Animal subjects: All authors have confirmed that this study did not involve animal subjects or tissue. Payment/services info: All authors have declared that no financial support was received from any organization for the submitted work. Other relationships: All authors have declared that there are no other relationships or activities that could appear to have influenced the submitted work.

Papapanou PN, Sanz M, Buduneli N, Dietrich T, Feres M, Fine DH, Flemmig TF, Garcia R, Giannobile WV, Graziani F, Greenwell H. Periodontitis: Consensus report of workgroup 2 of the 2017 World Workshop on the Classification of Periodontal and Peri-Implant Diseases and Conditions. Journal of periodontology. 2018;89:S173-82.
Martínez-García M, Hernández-Lemus E. Periodontal Inflammation and Systemic Diseases: An Overview. Front Physiol. 2021;12:709438. doi: 10.3389/fphys.2021.709438. PMID: 34776994; PMCID: PMC8578868.
Sedghi LM, Bacino M, Kapila YL. Periodontal Disease: The Good, The Bad, and The Unknown. Front Cell Infect Microbiol. 2021; 11:766944. doi: 10.3389/fcimb.2021.766944. PMID: 34950607; PMCID: PMC8688827.
Yang P, Shi F, Zhang Y. Baricitinib alleviates lipopolysaccharide-induced human periodontal ligament stem cell injury and promotes osteogenic differentiation by inhibiting JAK/STAT signaling. Exp Ther Med. 2022;25(2):74. doi: 10.3892/etm.2022.11773. PMID: 36684656; PMCID: PMC9842944.
Bertani B, Ruiz N. Function and Biogenesis of Lipopolysaccharides. EcoSal Plus. 2018;8(1):10.1128/ecosalplus.ESP-0001-2018. doi: 10.1128/ecosalplus.ESP-0001-2018. PMID: 30066669; PMCID: PMC6091223.
Rodas-Junco BA, Hernández-Solís SE, Serralta-Interian AA, Rueda-Gordillo F. Dental Stem Cells and Lipopolysaccharides: A Concise Review. Int J Mol Sci. 2024;25(8):4338. doi: 10.3390/ijms25084338. PMID: 38673923; PMCID: PMC11049850.
Page MJ, Kell DB, Pretorius E. The Role of Lipopolysaccharide-Induced Cell Signalling in Chronic Inflammation. Chronic Stress (Thousand Oaks). 2022;6:24705470221076390. doi: 10.1177/24705470221076390. PMID: 35155966; PMCID: PMC8829728.
Xiong G, Ji W, Wang F, Zhang F, Xue P, Cheng M, Sun Y, Wang X, Zhang T. Quercetin Inhibits Inflammatory Response Induced by LPS from Porphyromonas gingivalis in Human Gingival Fibroblasts via Suppressing NF-κB Signaling Pathway. Biomed Res Int. 2019;2019:6282635. doi: 10.1155/2019/6282635. PMID: 31531360; PMCID: PMC6720363.
Carrillo-Martinez EJ, Flores-Hernández FY, Salazar-Montes AM, Nario-Chaidez HF, Hernández-Ortega LD. Quercetin, a Flavonoid with Great Pharmacological Capacity. Molecules. 2024;29(5):1000. doi: 10.3390/molecules29051000. PMID: 38474512; PMCID: PMC10935205.
Frenț OD, Stefan L, Morgovan CM, Duteanu N, Dejeu IL, Marian E, Vicaș L, Manole F. A Systematic Review: Quercetin-Secondary Metabolite of the Flavonol Class, with Multiple Health Benefits and Low Bioavailability. Int J Mol Sci. 2024;25(22):12091. doi: 10.3390/ijms252212091. PMID: 39596162; PMCID: PMC11594109.
Georgiou N, Kakava MG, Routsi EA, Petsas E, Stavridis N, Freris C, Zoupanou N, Moschovou K, Kiriakidi S, Mavromoustakos T. Quercetin: A Potential Polydynamic Drug. Molecules. 2023;28(24):8141. doi: 10.3390/molecules28248141. PMID: 38138630; PMCID: PMC10745404.
Septembre-Malaterre A, Boumendjel A, Seteyen AS, Boina C, Gasque P, Guiraud P, Sélambarom J. Focus on the high therapeutic potentials of quercetin and its derivatives. Phytomed Plus. 2022;2(1):100220. doi: 10.1016/j.phyplu.2022.100220. Epub 2022 Jan 15. PMID: 35403087; PMCID: PMC8759805.
Wong SK, Chin KY, Ima-Nirwana S. Quercetin as an Agent for Protecting the Bone: A Review of the Current Evidence. Int J Mol Sci. 2020;21(17):6448. doi: 10.3390/ijms21176448. PMID: 32899435; PMCID: PMC7503351.
Chen FM, Gao LN, Tian BM, Zhang XY, Zhang YJ, Dong GY, Lu H, Chu Q, Xu J, Yu Y, Wu RX, Yin Y, Shi S, Jin Y. Treatment of periodontal intrabony defects using autologous periodontal ligament stem cells: a randomized clinical trial. Stem Cell Res Ther. 2016;7:33. doi:10.1186/s13287-016-0288-1. Erratum in: Stem Cell Res Ther. 2018;9(1):260. doi:10.1186/s13287-018-1000-4. PMID: 26895633; PMCID: PMC4761216
Nasiri K, Masoumi SM, Amini S, Goudarzi M, Tafreshi SM, Bagheri A, Yasamineh S, Alwan M, Arellano MTC, Gholizadeh O. Recent advances in metal nanoparticles to treat periodontitis. J Nanobiotechnology. 2023;21(1):283. doi: 10.1186/s12951-023-02042-7. PMID: 37605182; PMCID: PMC10440939.
Roy Chowdhury U, Kamath D, Rao P, Shenoy M S, Shenoy R. Indocyanine green based antimicrobial photodynamic therapy as an adjunct to non-surgical periodontal treatment in periodontal maintenance patients: a clinico-microbiological study. F1000Res. 2024;12:949. doi: 10.12688/f1000research.133230.2. PMID: 39296350; PMCID: PMC11409656.
Kwon T, Lamster IB, Levin L. Current Concepts in the Management of Periodontitis. Int Dent J. 2021;71(6):462–476. doi: 10.1111/idj.12630. Epub 2021 Feb 19. PMID: 34839889; PMCID: PMC9275292.
Liang Y, Luan X, Liu X. Recent advances in periodontal regeneration: A biomaterial perspective. Bioact Mater. 2020;5(2):297–308. doi: 10.1016/j.bioactmat.2020.02.012. PMID: 32154444; PMCID: PMC7052441.
Jin S, Jiang H, Sun Y, Li F, Xia J, Li Y, Zheng J, Qin Y. Osteogenic differentiation of periodontal membrane stem cells in inflammatory environments. Open Life Sci. 2022;17(1):1240–1248. doi: 10.1515/biol-2022-0474. PMID: 36213382; PMCID: PMC9490861.
Cortellini P, Tonetti MS. Clinical concepts for regenerative therapy in intrabony defects. Periodontol 2000. 2015;68(1):282–307. doi: 10.1111/prd.12048. PMID: 25867990.
Mooney EC, Holden SE, Xia XJ, Li Y, Jiang M, Banson CN, Zhu B, Sahingur SE. Quercetin Preserves Oral Cavity Health by Mitigating Inflammation and Microbial Dysbiosis. Front Immunol. 2021;12:774273. doi: 10.3389/fimmu.2021.774273. PMID: 34899728; PMCID: PMC8663773.
An S, Gao Y, Ling J. Characterization of human periodontal ligament cells cultured on three-dimensional biphasic calcium phosphate scaffolds in the presence and absence of L-ascorbic acid, dexamethasone and β-glycerophosphate in vitro. Exp Ther Med. 2015;10(4):1387–1393. doi: 10.3892/etm.2015.2706. Epub 2015 Aug 24. PMID: 26622495; PMCID: PMC4578067.
Bailey S, Karsenty G, Gundberg C, Vashishth D. Osteocalcin and osteopontin influence bone morphology and mechanical properties. Ann N Y Acad Sci. 2017;1409(1):79–84. doi: 10.1111/nyas.13470. Epub 2017 Oct 16. PMID: 29044594; PMCID: PMC5730490.
Shazam H, Shaikh F, Hussain Z, Majeed MM, Khan S, Khurshid Z. Evaluation of Osteocalcin Levels in Saliva of Periodontitis Patients and Their Correlation with the Disease Severity: A Cross-Sectional Study. Eur J Dent. 2020;14(3):352–359. doi: 10.1055/s-0040-1710143. Epub 2020 May 21. PMID: 32438432; PMCID: PMC7440941.
Guo Y, Zhang CQ, Zeng QC, Li RX, Liu L, Hao QX, Shi CH, Zhang XZ, Yan YX. Mechanical strain promotes osteoblast ECM formation and improves its osteoinductive potential. Biomed Eng Online. 2012;11:80. doi: 10.1186/1475-925X-11-80. PMID: 23098360; PMCID: PMC3502495.
Gomez-Florit M, Monjo M, Ramis JM. Quercitrin for periodontal regeneration: effects on human gingival fibroblasts and mesenchymal stem cells. Sci Rep. 2015;5:16593. doi:10.1038/srep16593. PMID: 26558438; PMCID: PMC4642307.
Wei Y, Fu J, Wu W, Ma P, Ren L, Yi Z, Wu J. Quercetin prevents oxidative stress-induced injury of periodontal ligament cells and alveolar bone loss in periodontitis. Drug Design, Development and Therapy. 2021 Aug 12:3509-22.

There is no conflict of interest

Download PDF

Editorial decision: revise
15 Dec, 2025
Review #1 received at journal
02 Dec, 2025
Reviewer #1 agreed at journal
27 Nov, 2025
Reviewers invited by journal
27 Nov, 2025
Submission checks completed at journal
24 Nov, 2025
Editor assigned by journal
21 Nov, 2025
First submitted to journal
21 Nov, 2025

You are reading this latest preprint version

Investigating the Osteogenic Potential of Quercetin in Lipopolysaccharide Treated Human Periodontal Ligament Stem Cells- an Invitro Study

Status:

Version 1

Abstract

Figures

INTRODUCTION

MATERIALS AND METHODS

Isolation and Cultivation of human Periodontal ligament Stem-cells (hPDLSCs)

Cell Culture

Experimental Groups

qPCR Analysis (Day 14 for OPN/OCN)

RNA Isolation and Reverse Transcription Quantitative PCR (RT-qPCR):

Statistical analysis

RESULTS

DISCUSSION

CONCLUSION

Declarations

References

Additional Declarations

Status:

Version 1